Información

Cuando se mide la longitud de los telómeros, ¿se realiza el método en una colección de células que arroja un promedio?

Cuando se mide la longitud de los telómeros, ¿se realiza el método en una colección de células que arroja un promedio?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

¿Cuáles son los métodos utilizados para medir los telómeros en sujetos humanos o animales?

¿Se puede hacer en una celda individual?

¿Se ha planteado y abordado anteriormente la siguiente preocupación:

¿Qué sucede si existe una variación natural en la longitud de los telómeros célula por célula y existen varios métodos (ejercicio extenuante, etc.) que ejercen presión de selección sobre la longitud de los telómeros? la longitud media aumenta mientras que en realidad ocurre algo más. Como resultado, todos estos estudios concluyeron que la longitud de los telómeros aumentó.


Un telómero se puede medir utilizando una prueba de peces de flujo. Básicamente, los marcadores fluorescentes que se unen al ADN se introducen en el núcleo de una célula, y luego esos marcadores se pueden contar usando un método llamado citometría de flujo.

Se puede hacer en una celda.

No estoy seguro de entender la última parte de la pregunta, pero puedo decir que si el tamaño promedio de telemore aumenta en un tamaño de muestra en particular, los científicos no concluirán nada basándose en esos datos.

Si hay una conclusión científica sobre el tamaño de los telómeros en relación con las presiones selectivas externas, habría datos estadísticamente significativos que explican adecuadamente las variaciones observadas en diferentes células.


Un método de PCR cuantitativa para medir la longitud absoluta de los telómeros

Describimos un método simple y reproducible para medir la longitud absoluta de los telómeros (aTL) mediante la reacción cuantitativa en cadena de la polimerasa en tiempo real (qPCR). Este método se basa en el método de Cawthon para la medición relativa de la longitud de los telómeros (TL) pero modificado mediante la introducción de un oligómero estándar para medir aTL. El método describe los estándares de oligómeros, la generación de la curva estándar y los cálculos necesarios para calcular aTL a partir de los datos de qPCR. Los controles necesarios y las características de rendimiento del ensayo se describen en detalle y se comparan con otros métodos para medir la TL. Se proporcionan los resultados típicos de este ensayo para una variedad de muestras de tejido humano, así como un programa de resolución de problemas. Este método permite la medición de alto rendimiento de aTL utilizando pequeñas cantidades de ADN, lo que lo hace apto para estudios epidemiológicos moleculares. En comparación con los ensayos de qPCR TL relativos tradicionales, el método aTL descrito en este protocolo permite una comparación más directa de los resultados entre experimentos dentro y entre laboratorios.


Fondo

Se cree ampliamente que las mujeres tienen telómeros más largos que los hombres, aunque los resultados de los estudios han sido contradictorios.

Métodos

Llevamos a cabo una revisión sistemática y metanálisis para probar la hipótesis de que en los humanos, las mujeres tienen telómeros más largos que los hombres y que esta asociación se vuelve más fuerte con el aumento de la edad. Las búsquedas se realizaron en EMBASE y MEDLINE (en noviembre de 2009) y se obtuvieron conjuntos de datos adicionales de los investigadores del estudio. Los estudios observacionales elegibles midieron los telómeros tanto para mujeres como para hombres de cualquier edad, tuvieron un tamaño de muestra mínimo de 100 e incluyeron participantes que no formaban parte de un grupo enfermo. Se calcularon estimaciones resumidas mediante metanálisis de efectos aleatorios. La heterogeneidad entre los estudios se investigó mediante análisis de subgrupos y metarregresión.

Resultados

Los metanálisis de 36 cohortes (36,230 participantes) mostraron que, en promedio, las mujeres tenían telómeros más largos que los hombres (diferencia estandarizada en la longitud de los telómeros entre mujeres y hombres 0,090; IC del 95%: 0,015; 0,166 ajustada por edad). Hubo poca evidencia de que estas asociaciones variaran según el grupo de edad (p = 1,00) o el tipo de célula (p = 0,29). Sin embargo, el tamaño de esta diferencia varió según los métodos de medición, y solo la transferencia Southern, pero ni la PCR en tiempo real ni el Flow-FISH mostraron una diferencia significativa. Esta diferencia no se asoció con un error de medición aleatorio.

Conclusiones

La longitud de los telómeros es mayor en las mujeres que en los hombres, aunque esta diferencia no se encontró universalmente en estudios que no utilizaron métodos de transferencia Southern. Se requiere más investigación sobre las explicaciones de las diferencias metodológicas.


Telómeros en estrés

Los telómeros protegen la integridad de los cromosomas. Se acortan con cada división celular en la mayoría de las células, ya que la telomerasa no está activa en la gran mayoría de las células humanas [10]. Se podría decir que se "sacrifican". Sobre todo porque perder una secuencia telomérica no es tan crítico para el estado metabólico actual de una célula como perder la secuencia de ADN que codifica una proteína. Otras funciones de los telómeros incluyen evitar que los cromosomas se unan o se reconocidos como roturas de doble hebra del ADN, que, a su vez, alertarían a los mecanismos de reparación del ADN [11]. Sin embargo, con el tiempo, la longitud de los telómeros en las células normales disminuye hasta que se vuelven demasiado cortos para desempeñar su función y mantener la capacidad de las células de dividirse. da como resultado la senescencia celular que es una de las principales causas del envejecimiento y los trastornos relacionados con el envejecimiento [12] asociados con el problema de la replicación final (límite de Hayflick) [13].

La expresión y la actividad de la telomerasa en las células humanas disminuyen con la edad [14]. Sin embargo, es un fenómeno individual y la tasa de desgaste de los telómeros está asociada, entre otros, con la capacidad de vencer el estrés. Como se sugirió, la actividad física (percibida como una de las principales formas de atenuar el nivel de estrés) se asocia con un envejecimiento saludable y un riesgo reducido de varios trastornos crónicos, posiblemente debido a la restauración de los telómeros [15, 16]. A nivel celular, el estrés se refiere a los factores que pueden afectar el metabolismo o pueden dañar la célula. Sin embargo, independientemente del nivel, el estrés se acumula progresivamente junto con el envejecimiento y puede afectar negativamente la salud y el bienestar del individuo. Es importante destacar que se demostró que los antioxidantes retrasan el inicio de la senescencia vascular de una manera dependiente de la telomerasa. En un estudio in vitro, se demostró que las especies reactivas de oxígeno (ROS) disminuyen el nivel de la proteína nuclear hTERT (transcriptasa inversa de la telomerasa humana) (la subunidad clave de la telomerasa) y la actividad de la telomerasa en las células endoteliales, lo que fue seguido por un desarrollo de fenotipo senescente. . Al mismo tiempo, la incubación con el antioxidante N-acetilcisteína bloqueó esta exportación nuclear de hTERT al citosol, lo que sugiere su papel en la respuesta al estrés [17]. Se demostró que otro antioxidante conocido, el a-tocoferol, reprime el acortamiento de los telómeros y retiene la actividad de la telomerasa en los endoteliocitos microvasculares del cerebro [18]. De manera similar, se demostró que el extracto de Ginko Biloba (de alto potencial antioxidante) retrasa el inicio de la senescencia mediante la activación de la telomerasa a través de la vía de señalización PI3k / Akt [19, 20]. Es importante destacar que el estrés crónico da como resultado un aumento de la secreción de cortisol que es capaz de suprimir la activación de la telomerasa en el sistema inmunológico y, en consecuencia, promover la atrición de los telómeros [21].

El hecho es que el envejecimiento se acompaña de atrición de los telómeros, aunque su tasa es muy heterogénea entre individuos, diferentes tipos de células pero también diferentes cromosomas [22]. Especialmente el último aspecto lleva a la conclusión de que las células pueden experimentar senescencia prematuramente, incluso cuando la longitud promedio de los telómeros es "normal", pero algunos extremos cromosómicos específicos son críticamente cortos. Dado que existen algunas vías bioquímicas comunes al envejecimiento, la respuesta al estrés y la atrición de los telómeros, creemos que los extremos de los cromosomas son marcadores de estrés muy sensibles e indicadores fiables del envejecimiento celular. Sin embargo, parece que la única forma de reconocer la longitud de los telómeros como un marcador de senescencia / envejecimiento / exposición al estrés es evaluar la longitud / tasa de desgaste de los cromosomas individuales individuales y no medir la longitud total de los telómeros en promedio.

Otro informe crucial fue demostrado por Garrett-Bakelman et al., Quienes demostraron un estudio asociado con la exposición a la gravedad disminuida. Como se muestra, un astronauta (Scott Kelly), que pasó casi un año en la estación espacial internacional, experimentó algunos síndromes graves (masa corporal reducida, inestabilidad en su genoma, hinchazón en los vasos sanguíneos principales, cambios en la forma de los ojos, cambios en el metabolismo, inflamación). y alteraciones en su microbioma) pero también un alargamiento significativo de los telómeros. Es importante destacar que los extremos del cromosoma se acortaron nuevamente después de que el astronauta aterrizó y regresó a los niveles casi previos al vuelo dentro de los 6 meses posteriores a su regreso a la Tierra. Sin embargo, se observó un mayor número de telómeros cortos y la expresión de algunos genes todavía estaba alterada. Al mismo tiempo, su hermano gemelo idéntico (que no pasó el tiempo en el espacio) fue monitoreado como referencia y no mostró alteraciones significativas en la longitud de los telómeros [23]. Este caso muestra lo compleja que es la regulación de los telómeros.


Métodos

Sujetos y controles

Estudio de salud pulmonar (LHS). El estudio utilizó datos clínicos y materiales biológicos obtenidos en el Lung Health Study (LHS), un ensayo clínico patrocinado por el Instituto Nacional del Corazón, los Pulmones y la Sangre. Luego de recibir el consentimiento informado por escrito, el LHS inscribió inicialmente a 5887 fumadores, de 35 años y 60 años con limitación leve a moderada del flujo de aire (definida como una proporción de volumen espiratorio forzado en un segundo (FEV1) a la capacidad vital forzada (FVC) & # x022640.70 y 55 & # x0003cFEV1& # x0003c90 & # x00025) en 10 centros de América del Norte [15]. Personas que tenían antecedentes de cáncer (excepto carcinoma in situ o carcinoma de células basales de piel), infarto de miocardio (en los últimos dos años), angina, insuficiencia cardíaca, accidente cerebrovascular (en los últimos dos años), insuficiencia renal, insulina. que requirieran diabetes mellitus, cirrosis u otras enfermedades hepáticas graves, embolia pulmonar, trastornos del sistema nervioso central, glaucoma de ángulo estrecho o cualquier otra enfermedad importante que pudiera haber comprometido el seguimiento [16].

Durante los primeros 5 años de seguimiento, se evaluó anualmente la función pulmonar y el tabaquismo de los participantes. Los participantes se clasificaron como personas que dejaron de fumar de forma sostenida si eran no fumadores validados en cada visita anual. Los participantes que eran fumadores en cada visita anual eran fumadores continuos. Aquellos cuyo comportamiento de fumar varió se clasificaron como personas que abandonaron el hábito de manera intermitente. En el año 5, 4.803 participantes proporcionaron muestras de sangre (que representan el 89 & # x00025 de los participantes elegibles). Las muestras de sangre se separaron en sus partes componentes y se almacenaron en congeladores & # x0221270 & # x000b0C hasta su uso. Los participantes del estudio fueron seguidos pasivamente hasta finales de 2001 durante una mediana de seguimiento de 7,5 años desde la fecha de la punción venosa hasta el cierre del estudio. Durante el seguimiento, se registraron el estado vital y las hospitalizaciones de los participantes. Una junta de mortalidad y morbilidad revisó todos los registros de pacientes, incluidos certificados de defunción, relatos de testigos oculares, registros de necropsias, resúmenes de entrevistas con los médicos tratantes y registros de hospitalización, y asignó una causa a la mortalidad de todos los fallecidos. Estos datos se complementaron con un índice nacional de defunción que proporcionó la fecha y la causa de la muerte de todos los participantes del estudio de EE. UU. [16]. Los puntos finales de mortalidad se agruparon en: enfermedad coronaria, enfermedad cardiovascular (que también incluía enfermedad coronaria), cáncer de pulmón, todos los cánceres (que incluía cáncer de pulmón), enfermedad respiratoria excluyendo cáncer de pulmón, otros y desconocidos.

Cohorte de estudio sobre envejecimiento saludable. Para comparar las longitudes de los telómeros de sujetos con EPOC en LHS con un grupo de control sin EPOC, utilizamos datos de telómeros de sujetos de mediana edad del Estudio de Envejecimiento Saludable, que tenían entre 40 y 50 años de edad y fueron reclutados al azar sin tener en cuenta su salud o estado de la enfermedad (es decir, controles & # x0201cnegativos & # x0201d) [17].

Advair, cohorte de Biomarcadores en EPOC (ABC). Como segundo grupo de control (es decir, controles & # x0201cpositivos & # x0201d), medimos la longitud de los telómeros de los leucocitos periféricos obtenidos de pacientes con EPOC de moderada a grave, según la definición espirométrica del FEV.1/ Relación FVC inferior a 70 & # x00025 y FEV1 menos del 80 & # x00025 de los previstos, que tenían al menos 10 paquetes de antecedentes de tabaquismo y tenían al menos 40 años de edad [18]. Los resultados de este estudio se han publicado previamente [13].

Extracción de ADN de leucocitos

La concentración de ADN de sangre periférica recolectada en el año 5 se determinó usando un espectrofotómetro NanoDrop 8000 (Thermo Scientific, Wilmington, EE. UU.). Las muestras de ADN se diluyeron a 1 ng / & # x000b5L en tampón Tris-EDTA 1 & # x000d7 y se almacenaron a & # x0221220 & # x000b0C para uso posterior en la reacción en cadena de la polimerasa cuantitativa (qPCR).

Medición de la longitud de los telómeros

Los telómeros de leucocitos de sangre periférica se midieron utilizando un protocolo de qPCR modificado descrito por Cawthon [19]. Las secuencias de cebadores (escritas 5 & # x02032 & # x021923 & # x02032) fueron: tel 1, GGTTTTTGAG -GGTGAGGGTGAGGGTGAGGGTGAGGGT tel 2, TCCCGACTATCCCTATCCCTATCCC -TATCCCTATCCCTA 36B4u, CAGCAAGTGGGAAGGTGTAATCC 36B4d, CCCATTCTA -TCATCAACGGGTACAA. El gen de copia única de referencia utilizado fue 36B4 y las concentraciones finales de los cebadores (Sigma, The Woodlands, TX) fueron tel 1, 270 nM tel 2, 900 nM, 36B4u, 300 nM 36B4d, 500 nM.

La medición de la longitud de los telómeros se realizó por triplicado para todas las muestras en una placa de reacción óptica transparente de 384 pocillos (Applied Biosystems, Foster City, CA). El ADN de referencia obtenido del Coriell Institute (Camden, NJ) se analizó por triplicado en cada placa de PCR para tener en cuenta la variación de la medición entre placas. Cada pocillo contenía 10 & # x000b5L QuantiTect SYBR Green PCR Master Mix (QIAGEN, Mississauga, ON) y una concentración final de ADN de 0,25 ng / & # x000b5L. Después de la carga, las placas se sellaron con película adhesiva óptica MicroAmp (Applied Biosystems, Foster City, CA) y se centrifugaron brevemente a 2.500 rpm. Las reacciones se realizaron en un sistema de detección de secuencias ABI PRISM 7900HT (Applied Biosystems, Foster City CA). El perfil de ciclos térmicos para la amplificación de genes de copia única y de telómeros comenzó con 50 ° C durante 2 minutos y luego con 95 ° C durante 2 minutos. Para la PCR de telómeros, siguieron 30 ciclos de 95 ° C durante 15 segundos y 54 ° C durante 2 minutos. El perfil de ciclo de 36B4 fue seguido por 35 ciclos de 95 ° C durante 15 segundos y 58 ° C durante 1 minuto. La longitud de los telómeros se cuantificó como una relación T / S relativa (T & # x0200a = & # x0200atelómero, S & # x0200a = & # x0200 un gen de copia única), calculada según la fórmula de Cawthon [19].

Análisis estadístico

Las longitudes de los telómeros de los leucocitos de sangre periférica se estandarizaron para el gen de copia única de referencia (T / S). Para fines analíticos, los participantes se dividieron en cuartiles según su relación T / S. A continuación, se compararon las características clínicas utilizando una prueba de chi-cuadrado para las variables dicotómicas (utilizando los grados de libertad apropiados) y la prueba de Cochran-Armitage para la tendencia de las variables continuas. El criterio de valoración principal de este estudio fue la mortalidad por todas las causas. Comparamos el riesgo de mortalidad por todas las causas en los cuartiles durante el período de seguimiento utilizando un método de Kaplan-Meier (K-M) para el análisis univariado y un modelo de riesgos proporcionales de Cox para el análisis multivariado. Las curvas de supervivencia K-M en los cuartiles T / S se compararon mediante una prueba de rango logarítmico. En el modelo multivariado, incluimos las siguientes covariables: edad, sexo, índice de masa corporal (IMC), tabaquismo durante los primeros 5 años de seguimiento, paquetes-año de tabaquismo, presión arterial al año 5 y FEV.1 en el año 5. FEV1, El IMC, las mediciones de la presión arterial y los paquetes-año de tabaquismo no afectaron significativamente los resultados del modelo. Por lo tanto, fueron descartados en el análisis final. Se utilizó un enfoque similar para los criterios de valoración de mortalidad por causas específicas. Las relaciones T / S entre los grupos de fumadores se compararon mediante la prueba de Kruskal-Wallis, ya que los datos no estaban distribuidos normalmente. Correlaciones entre el cociente T / S y variables como el FEV1 a los 5 años y la edad se evaluaron mediante la prueba de Spearman para variables no paramétricas. Los valores de p menores de 0,05 (utilizando una prueba de dos colas) se consideraron significativos. Todos los análisis se realizaron utilizando SAS (versión 9.1, Carey, N.C.). El uso de muestras de los estudios LHS y ABC fue aprobado por la Junta de Ética en Investigación de Providence Health Care / UBC. El uso de muestras del Estudio de Envejecimiento Saludable fue aprobado por la Junta de Ética de Investigación Clínica conjunta de UBC y la Agencia de Cáncer de Columbia Británica.


Resultados

Las estadísticas descriptivas y las diferencias de grupo entre las variables de estudio se presentan en la Tabla 1. Las correlaciones bivariadas se presentan en la Tabla 2. Como se muestra en estas tablas, hubo diferencias grupales en el peso al nacer y el coeficiente intelectual. Además, el peso al nacer, el coeficiente intelectual y el sexo se asociaron de forma variable con la psicopatología. Por lo tanto, volvimos a ejecutar modelos de trayectoria separados con cada sexo, coeficiente intelectual y peso al nacer como covariables y los resultados no difirieron sustancialmente. Como se ve en la Tabla 1, no hubo asociaciones directas entre la longitud de los telómeros en ningún momento y el estado del grupo & # x02013 comparando NIG con EIG o FCG con CAUG. Como se ve en la Tabla 2, hubo estabilidad de orden de rango en TL a lo largo del tiempo, lo que significa que los individuos con telómeros más cortos a la edad de 8 años tendían a tener telómeros más cortos a los 12 años en comparación con aquellos con telómeros más largos. Además, de acuerdo con estudios anteriores, hubo un acortamiento de los telómeros con el tiempo en toda la muestra, t (gl = 76) = 3,01, pag = .004.

Tabla 1:

Características y estadísticas descriptivas entre niños institucionalizados y nunca institucionalizados

Edad 8 & # x0201310 Medidas
Todos los participantesSolo niños institucionalizados
EIG (norte= 96)NIG (norte= 99)t o & # x003c7 2 CAUG (norte= 44)FCG (norte= 52)t o & # x003c7 2
Sexo masculino)52.1%48.5%.2552.351.9.001
Peso al nacer (g)2755.23208.05.06 *** 2847.52675.01.33
IQ de escala completa80.2100.29.30 *** 78.281.91.29
Factor general.45& # x02212.446.84 *** .51.40.57
Factor de internalización.04& # x02212.04.63.12& # x02212.02.69
Factor de externalización.00.00.06.06& # x02212.04.44
Longitud del telómero1.601.59.061.531.65.74
Edad 12 & # x0201314 Medidas
Todos los participantesSolo niños institucionalizados
EIG (norte= 112)NIG (norte= 50)t o & # x003c7 2 CAUG (norte= 56)FCG (norte= 56)t o & # x003c7 2
Sexo masculino)51.846.0.4651.851.8& # x0003c.001
Peso al nacer (g)2799.53244.94.29 *** 2878.62722.01.31
IQ de escala completa72.398.19.00 *** 68.675.82.19 *
Factor general.20& # x02212.444.29 *** .34.061.52
Factor de internalización& # x02212.05.111.22& # x02212.01& # x02212.09.58
Factor de externalización.16& # x02212.374.44 *** .23.10.63
Longitud del telómero1.401.43.641.381.41.59

Nota: Todas las estadísticas son medias excepto el sexo (%). Las variables generales, internalizantes y externalizantes son puntuaciones de factores con una media muestral total de cero.

El coeficiente intelectual se evaluó mediante el WISC-IV. El peso al nacer se mide en gramos. Las puntuaciones de longitud de los telómeros no están ajustadas en esta tabla.

Tabla 2:

Correlaciones bivariadas entre las variables del estudio y otras características del niño

1.2.3.4.5.6.7.8.9.10.11.
1. Factor general (8 años & # x0201310)& # x02013
2. Factor de internalización (8 años & # x0201310).00& # x02013
3. Factor de externalización (8 años & # x0201310).00.02& # x02013
4. Longitud de los telómeros (8 años & # x0201310)& # x02212.02& # x02212.19 & # x000a7 .03& # x02013
5. Factor general (12 años & # x0201314).29 ** .00& # x02212.09.18& # x02013
6. Factor de internalización (12 años & # x0201314)& # x02212.23 ** .12.04.03.15 & # x000a7 & # x02013
7. Factor de externalización (12 años y # x0201314).37 *** & # x02212.04.06& # x02212.02.04& # x02212.25 ** & # x02013
8. Longitud de los telómeros (12 años y # x0201314)& # x02212.05& # x02212.25 ** .08.35 ** & # x02212.22 ** & # x02212.05& # x02212.01& # x02013
9. Sexo (masculino).15 * & # x02212.07& # x02212.05.01.16 * .01.24 ** & # x02212.01& # x02013
10. Peso al nacer& # x02212.23 ** & # x02212.09.23 ** .01& # x02212.22 ** & # x02212.13& # x02212.11& # x02212.16 & # x000a7 .09& # x02013
11. FSIQ (8 años & # x0201310)& # x02212.54 *** & # x02212.10.05.04& # x02013& # x02013& # x02013& # x02013& # x02212.08.34 *** & # x02013
12. FSIQ (12 años & # x0201314)& # x02013& # x02013& # x02013& # x02013& # x02212.31 *** .12& # x02212.32 *** .02& # x02212.08.29 ** .90 ***

Dados los hallazgos previos de las relaciones específicas por sexo entre la duración de la atención institucional y la longitud de los telómeros, presentamos correlaciones entre la cantidad de tiempo pasado en instituciones entre EIG (porcentaje de una vida hasta una edad determinada) y la longitud de los telómeros para hombres y mujeres. participantes en la Tabla S1, disponible en línea. Una mayor duración de la atención institucional a los 54 meses y 8 años de edad se asoció con una menor longitud de los telómeros a la edad de 8 años en los participantes masculinos. En las participantes femeninas, una mayor duración de la atención institucional al inicio del estudio y 54 meses se asoció con una menor longitud de los telómeros a la edad de 12 años & # x0201314. Se correlacionó la cantidad de tiempo pasado en las instituciones a lo largo del tiempo (Tabla S2, disponible en línea). Cuando se examinó la duración de la atención institucional y la longitud de los telómeros dentro de FCG y CAUG (teniendo en cuenta el sexo), una mayor exposición a la atención institucional a los 54 meses, 8 años y 12 años se asoció con una longitud de los telómeros más corta a los 12 años & # x0201314 entre los CAUG, pero no FCG (Tabla S3, disponible en línea). Las diferencias de sexo no se examinaron dentro de los grupos FCG y CAUG debido a limitaciones de potencia. Ampliamos estos hallazgos en el Suplemento 1. Por lo tanto, existen asociaciones entre la duración de la institucionalización y la longitud de los telómeros que varían según el sexo y la edad de evaluación en lugar de asociaciones directas entre el grupo de institucionalización y la longitud de los telómeros. La fuerte relación entre el estado de institucionalización (NIG = 0 EIG = 1) y la psicopatología justifica su inclusión como covariable en el modelo primario, que se describe a continuación.

Asociación entre la longitud de los telómeros y la psicopatología

El modelo de trayectoria longitudinal que describe la relación entre la longitud de los telómeros y los factores generales, internalizantes y externalizantes se presenta en la Figura 1. El ajuste del modelo fue aceptable: RMSEA = .069 [.02, .11], PCLOSE = .22, CFI = .90 y SRMR = .05. Los niños con EIG tenían una psicopatología general significativamente más alta a los 8 años y # x0201310 que con NIG, sin embargo, el estado de institucionalización no estaba relacionado con la internalización o externalización a los 8 años y # x0201310 después de tomar en cuenta el factor general. Además, hubo una relativa estabilidad en la psicopatología general a lo largo del tiempo, independientemente del estado institucional, pero poca estabilidad en la internalización o externalización después de tener en cuenta la estabilidad en el factor general.

Nota. Los parámetros están estandarizados & # x003b2 coeficientes. Los factores psicopatológicos son puntuaciones de factores que se guardan del modelo bi-factor latente y se utilizan como variables manifiestas. Solo se muestran las relaciones entre la longitud de los telómeros y la psicopatología. Consulte la Tabla 1 para ver las asociaciones entre las puntuaciones de los factores psicopatológicos. EIG = grupo siempre institucionalizado NIG = nunca institucionalizado.

En términos de dentro del tiempo asociaciones, la longitud más corta de los telómeros a la edad de 8 años se asoció significativamente con problemas de internalización más altos, pero no estaba relacionada con la psicopatología general o externa. Por otro lado, la menor longitud de los telómeros a los 12 años se asoció con una mayor psicopatología general, pero no internalizante ni externalizante. Finalmente, a través del tiempo efectos (es decir, asociaciones cruzadas) revelaron que una psicopatología de internalización más alta a los 8 años & # x0201310 predijo una longitud de telómeros más corta a los 12 años & # x0201314 después de controlar la longitud de los telómeros a los 8 años & # x0201310. Este efecto puede interpretarse como una mayor psicopatología de internalización que predice cambios en la longitud de los telómeros desde los 8 años & # x0201310 hasta los 12 & # x0201314. Ni la psicopatología general ni la externa a los 8 años se asociaron con la longitud de los telómeros a los 12 años y no surgieron efectos recíprocos de la longitud de los telómeros en la psicopatología. Todos los efectos se probaron simultáneamente y condicionados a todos los demás efectos en el modelo. Como no se trataba de pruebas independientes, no se requirió corrección para pruebas múltiples.

Finalmente, de acuerdo con la intención original del ECA, examinamos si las asociaciones entre los factores psicopatológicos y la longitud de los telómeros diferían entre: (i) EIG y NIG, y (ii) CAUG y FCG. El último modelo ofreció un ajuste deficiente a los datos, probablemente debido a una potencia inadecuada dado el pequeño tamaño de la muestra de los grupos CAUG y FCG. Los resultados del modelo anterior se proporcionan en el Suplemento 1, disponible en línea. Como no hubo diferencias observables en las rutas que vinculan la psicopatología y la longitud de los telómeros entre los niños EIG y NIG, el modelo primario anterior colapsó en todos los niños.


Agradecimientos

Esta revisión es el resultado de discusiones y colaboraciones que surgen de un taller sobre la dinámica de los telómeros en organismos no modelo. El taller fue apoyado por una Beca de Taller Internacional BBSRC y apoyo adicional de la Sociedad de Genética y Agilent Technologies, y de un Premio de Investigador Avanzado del Consejo Europeo de Investigación a PM. Agradecemos a todos los asistentes al taller por su contribución a nuestras discusiones sobre los métodos de medición de los telómeros, y a Abraham Aviv, Hannah Froy y Francois Criscuolo por sus comentarios sobre los borradores de manuscritos. DHN cuenta con el apoyo de una beca BBSRC David Phillips.

Nombre del archivo Descripción
mee312161-sup-0001-TableS1.docxDocumento de Word, 16,1 KB Cuadro S1. Lista de métodos de extracción de ADN y almacenamiento de tejidos y especies y su idoneidad para el análisis posterior de la longitud de los telómeros, según la experiencia pasada de los autores y las comunicaciones personales con los colegas. AE y TE se refieren a soluciones tampón de uso común: AE es una mezcla de acetato de sodio y EDTA, TE de solución Tris y EDTA.

Tenga en cuenta: El editor no es responsable del contenido o la funcionalidad de la información de apoyo proporcionada por los autores. Cualquier consulta (que no sea contenido faltante) debe dirigirse al autor correspondiente del artículo.


El material complementario electrónico está disponible en línea en https://doi.org/10.6084/m9.figshare.c.5001038.

Publicado por la Royal Society bajo los términos de la licencia de atribución Creative Commons http://creativecommons.org/licenses/by/4.0/, que permite el uso sin restricciones, siempre que se acredite el autor y la fuente originales.

Referencias

. 2006 ¿La dinámica de los telómeros vincula el estilo de vida y la esperanza de vida? Tendencias Ecol. Evol. 21, 47-53. (doi: 10.1016 / j.tree.2005.11.007) Crossref, PubMed, ISI, Google Académico

. 2010 Telómeros e historias de vida: lo largo y lo corto. Ana. NY Acad. Sci. 1206130-142. (doi: 10.1111 / j.1749-6632.2010.05705.x) Crossref, PubMed, ISI, Google Académico

Haussmann MF, Marchetto NM

. 2010 Telómeros: vinculando estrés y supervivencia, ecología y evolución. Canalla. Zool. 56, 714-727. (doi: 10.1093 / czoolo / 56.6.714) Crossref, ISI, Google Académico

Olsson M, Wapstra E, Friesen CF

. 2018 Ecología evolutiva de los telómeros: una revisión. Ana. NY Acad. Sci. 1422, 5-28. (doi: 10.1111 / nyas.13443) Crossref, PubMed, ISI, Google Académico

Olsson M, Wapstra E, Friesen CR

. 2018 Telómeros ectotérmicos: es hora de que vengan del frío. Phil. Trans. R. Soc. B 373, 20160449. (doi: 10.1098 / rstb.2016.0449) Enlace, ISI, Google Académico

Gomes N, Shay JW, Wright WE

. 2010 Biología de los telómeros en Metazoa. FEBS Lett. 584, 3741-3751. (doi: 10.1016 / j.febslet.2010.07.031) Crossref, PubMed, ISI, Google Académico

. 2015 Reparación por escisión de ADN en los telómeros. Reparación de ADN 36137-145. (doi: 10.1016 / j.dnarep.2015.09.017) Crossref, PubMed, ISI, Google Académico

. 2018 ADN Daño, reparación y mantenimiento de la longitud de los telómeros: papel de los suplementos nutricionales. En Mutagenicidad: ensayos y aplicaciones (eds

Kumar A, Dobrovolsky VN, Dhawan A, Shanker R

), págs.287-307. Amsterdam, Países Bajos: Elsevier. Google Académico

2017 Prevalencia y etiología del cáncer en animales salvajes y cautivos. En Ecología y evolución del cáncer (eds

Ujvari B, Roche B, Thomas F

), págs. 11-46. Londres, Reino Unido: Academic Press. Crossref, académico de Google

. 2009 Telómeros y enfermedad. EMBO J. 28, 2532-2540. (doi: 10.1038 / emboj.2009.172) Crossref, PubMed, ISI, Google Académico

. 2012 Los síndromes de los telómeros. Nat. Rev. Genet. 13, 693-704. (doi: 10.1038 / nrg3436) Crossref, PubMed, ISI, Google Académico

Stone RC, Horvath K, Kark JD, Susser E, Tishkoff SA, Aviv A

. 2016 Longitud de los telómeros y compensación entre cáncer y aterosclerosis. PLoS Genet. 12, e1006144. (doi: 10.1371 / journal.pgen.1006144) Crossref, PubMed, ISI, Google Académico

Barrett ELB, Richardson DS

. 2011 Diferencias de sexo en telómeros y esperanza de vida. Célula de envejecimiento 10, 913-921. (doi: 10.1111 / j.1474-9726.2011.00741.x) Crossref, PubMed, ISI, Google Académico

2014 Género y longitud de los telómeros: revisión sistemática y metanálisis. Exp. Gerontol. 51, 15-27. (doi: 10.1016 / j.exger.2013.12.004) Crossref, PubMed, ISI, Google Académico

Rollings N, Friesen CR, Sudyka J, Whittington C, Giraudeau M, Wilson M, Olsson M

. 2017 Dinámica de los telómeros en un lagarto con inversión reproductiva y auto-mantenimiento específicos de la morfología. Ecol. Evol. 7, 5163-5169. (doi: 10.1002 / ece3.2712) Crossref, PubMed, ISI, Google Académico

Asghar M, Palinauskas V, Zaghdoudi-Allan N, Valkiunas G, Mukhin A, Platonova E, Farnert A, Bensch S, Hasselquist D

. 2016 Acortamiento paralelo de los telómeros en múltiples tejidos corporales debido a la infección por malaria. Proc. R. Soc. Lond. Biol. Sci. 283, 20161184. (doi: 10.1098 / rspb.2016.1184) Enlace, ISI, Google Académico

Rollings N, Friesen CR, Whittington CM, Johansson R, Shine R, Olsson M

. 2019 Diferencias específicas de tejido y sexo en la longitud de los telómeros en un reptil. Ecol. Evol. 9, 6211-6219. (doi: 10.1002 / ece3.5164) PubMed, ISI, Google Académico

Benetos A, Kimura M, Labat C, Buchoff GM, Huber S, Labat L, Lu XB, Aviv A

. 2011 Un modelo de la dinámica de los telómeros leucocitarios caninos. Célula de envejecimiento 10, 991-995. (doi: 10.1111 / j.1474-9726.2011.00744.x) Crossref, PubMed, ISI, Google Académico

Daniali L, Benetos A, Susser E, Kark JD, Labat C, Kimura M, Desai K, Granick M, Aviv A

. 2013 Los telómeros se acortan a tasas equivalentes en los tejidos somáticos de los adultos. Nat. Comun. 4, 1597. (doi: 10.1038 / ncomms2602) Crossref, PubMed, ISI, Google Scholar

Reichert S, Criscuolo F, Verinaud E, Zahn S, Massemin S

. 2013 Correlaciones de la longitud de los telómeros entre los tejidos somáticos en pinzones cebra adultos. Más uno 8, e81496. (doi: 10.1371 / journal.pone.0081496) Crossref, PubMed, ISI, Google Académico

. 2004 Hematología de vertebrados inferiores. En la 55ª Reunión Anual del Colegio Americano de Patólogos Veterinarios (ACVP) y la 39ª Reunión Anual de la Sociedad Americana de Patología Clínica (ASVCP). Middleton, WI: Colegio Estadounidense de Patólogos Veterinarios y Sociedad Estadounidense de Patología Clínica Veterinaria. Google Académico

Beaulieu M, Benoit L, Abaga S, Kappeler PM, Charpantier MJE

. 2017 Cuidado con la célula: la variación estacional en la longitud de los telómeros refleja los cambios en el perfil de leucocitos. Mol. Ecol. 26, 5603-5613. (doi: 10/1111 / mec.14329) Crossref, PubMed, ISI, Google Académico

. 2009 Morfología comparativa, desarrollo y función de las células sanguíneas en vertebrados no mamíferos. J. Exot. Mascota. Medicina. 18, 87-97. Crossref, ISI, Google Académico

. 2019 Fisiología de los glóbulos rojos y blancos. Anaesth. Med de cuidados intensivos. 20, 170-174. (doi: 10.1016 / j.mpaic.2019.01.001) Crossref, ISI, Google Académico

. 2002 El estrés oxidativo acorta los telómeros. Trends Biochem. Sci. 27, 339-344. (doi: 10.1016 / S0968-0004 (02) 02110-2) Crossref, PubMed, ISI, Google Académico

Baerlocher GM, Lansdorp PM

. 2003 Mediciones de la longitud de los telómeros en subconjuntos de leucocitos mediante Flow-FISH multicolor automatizado. Citometría Parte A 55A, 1-6. (doi: 10.1002 / cyto.a.10064) Crossref, ISI, Google Académico

Carvalho de MP, Queiroz-Hazarbassanov NG, Massoco CO, Rossi S, Sant'Anna SS, Catão-Dias JL, Grego KF

. 2016 Caracterización citométrica de flujo de poblaciones de leucocitos de sangre periférica de 3 especies de serpientes neotropicales: Boa constrictor, Bothrops jararaca, y Crotalus durissus . Veterinario. Clin. Pathol. 45, 271-280. (doi: 10.1111 / vcp.12358) Crossref, PubMed, ISI, Google Académico

Carvalho de MPN, Queiroz-Hazarbassanov NGT, de Oliveira Massoco C, Sant'Anna SS, Lourenço MM, Levin G, Sogayar MC, Grego KF, Catão-Dias JL

. 2017 Caracterización funcional de subconjuntos de leucocitos de sangre periférica de serpientes neotropicales: vinculación de características celulares de citometría de flujo, imágenes microscópicas y niveles séricos de corticosterona. Dev. Comp. Immunol. 74, 144-153. (doi: 10.1016 / j.dci.2017.04.007) Crossref, PubMed, ISI, Google Académico

Olsson M, Friesen CR, Rollings N, Sudyka J, Lindsay W, Whittington C, Wilson MR

. 2018 Efectos a largo plazo de la reparación del ADN y el superóxido en los telómeros de los lagartos. Mol. Ecol. 27, 5154-5164. (doi: 10.1111 / mec.14913) Crossref, PubMed, ISI, Google Académico

Rollings N, Friesen CR, Sudyka J, Whittington C, Wilson M, Olsson M

. 2017 Dinámica de los telómeros en un lagarto con inversión reproductiva y auto-mantenimiento específicos de la morfología. Ecol. Evol. 7, 5163-5169. (doi: 10.1002 / ece3.2712) Crossref, PubMed, ISI, Google Académico

Olsson M, Healey M, Wapstra E, Schwartz T, Lebas N, Uller T

. 2007 Variación del sistema de apareamiento y fluctuaciones de la morfología en un lagarto polimórfico. Mol. Ecol. 16, 5307-5315. (doi: 10.1111 / j.1365-294X.2007.03578.x) Crossref, PubMed, ISI, Google Académico

Olsson M, Healey M, Wapstra E, Uller T

. 2009 Prueba de la calidad de un portador: un experimento de campo sobre señalizadores de lagartos. Evolución 63, 695-701. (doi: 10.1111 / j.1558-5646.2008.00569.x) Crossref, PubMed, ISI, Google Académico

. 2009 Demasiado grande para sus botas: ¿son los costos sociales que mantienen el estatus dependiente de la condición como una señal honesta en un lagarto australiano? Austral Ecol. 34, 636-640. (doi: 10.1111 / j.1442-9993.2009.01968.x) Crossref, ISI, Google Académico

. 2000 Chapter 21: Reptilian complete blood count . En Laboratory medicine: avian and exotic pets (ed.

), pp. 193-197. Philadelphia, PA : W.B. Saunders Company . Google Académico

Stacy NI, Alleman AR, Sayler KA

. 2011 Diagnostic hematology of reptiles . Clin. Laboratorio. Medicina. 31, 87-108. (doi:10.1016/j.cll.2010.10.006) Crossref, PubMed, ISI, Google Scholar

. 2008 Hematologic evaluation is mainstay of diagnosis for reptiles . Vet. Tech. 29, 616. Google Scholar

Nazarpour R, Zabihi E, Alijanpour E, Abedian Z, Mehdizadeh H, Rahimi F

. 2012 Optimization of human peripheral blood mononuclear cells (PBMCs) cryopreservation . En t. J. Mol. Celda. Medicina. 1, 88-93. PubMed, Google Académico

. 1991 Structure and function of telomeres . Naturaleza 350, 569-573. (doi: 10.1038/350569a0) Crossref, PubMed, ISI, Google Scholar

Fischer U, Ototake M, Nakanishi T

. 1998 Lifespan of circulating blood cells in ginbuna crucian carp (Carassius auratus langsdorfii) . Fish Shellfish Immunol. 8, 339-349. (doi:10.1006/fsim.1998.0144) Crossref, ISI, Google Scholar

Asghar M, Hasselquist D, Hansson B, Zehtindjiev P, Westerdahl H, Bensch S

. 2015 Hidden costs of infection: chronic malaria accelerates telomere degradation and senescence in wild birds . Ciencias 347, 436-438. (doi10.1126/science.1261121) Crossref, PubMed, ISI, Google Scholar

Angelier F, Costantini D, Blévin P, Chastel O

. 2018 Do glucocorticoids mediate the link between environmental conditions and telomere dynamics in wild vertebrates? Una revisión . Gen. Comp. Endocrinol. 256, 99-111. (doi:10.1016/j.ygcen.2017.07.007) Crossref, PubMed, ISI, Google Scholar

Kurz DJ, Decary S, Hong Y, Trivier E, Akhmedov A, Erusalimsky JD

. 2004 Chronic oxidative stress compromises telomere integrity and accelerates the onset of senescence in human endothelial cells . J. Cell Sci. 117, 2417-2426. (doi:10.1242/jcs.01097) Crossref, PubMed, ISI, Google Scholar

Fouquerel E, Parikh D, Opresko P

. 2016 DNA damage processing at telomeres: the ends justify the means . Reparación de ADN 44, 159-168. (doi:10.1016/j.dnarep.2016.05.022) Crossref, PubMed, ISI, Google Scholar

Sardina JL, Lopez-Ruano G, Sanchez-Sanchez B, Llanillo M, Hernandez-Hernandez A


Design and methods

Setting and subjects

This analysis was performed within the framework of the Prevention of Renal and Vascular End-Stage Disease (PREVEND, www.prevend.org) study. The PREVEND study is an ongoing, longitudinal, general, population-based cohort study of individuals aged 28–75 years living in the city of Groningen, the Netherlands. For the present study, we included subjects who donated a full blood sample for DNA extraction at baseline (T1) and/or during the first (T2) and/or the second (T3) follow-up visit. Details of the study have been described previously 15 . In brief, 8592 subjects completed the baseline survey (1997–1998) and were invited to visit the outpatient department after approximately 4.3 years for the first and approximately 6.6 years for the second follow-up visit. At each visit, demographic and anthropometric characteristics and serum biomarkers were assessed. The PREVEND study has been approved by the local medical ethics committee and is being conducted in accordance with the guidelines of the Declaration of Helsinki. All participants provided written informed consent before enrolment.

Measurement of telomere length

Details of the methods of DNA extraction and of telomere length measurements are provided in the Appendix S1. In brief, all samples for DNA collected at different time-points were mixed and randomly extracted using a standard DNA extraction kit (QIamp, Qiagen, Venlo, the Netherlands) to neutralize potential batch effects. Mean relative leukocyte telomere length was measured using a monochrome multiplex real-time quantitative polymerase chain reaction technique (developed by R.M.C.) 16 . This technique enables the telomere-specific amplification and the single copy gene (reference) amplification to be carried out in a single reaction well with quantification measurements at different temperatures 16 . The ratio of telomere (T) to single copy gene (S) content (T/S ratio) is a relative measure of telomere length (RTL) and is expressed in arbitrary units (RTLU). All samples were measured in triplicate, and the average of the three runs was used to provide the mean RTLU for each individual. The intra-assay coefficients of variation were 2.0%, 1.9% and 4.5% for T, S and the T/S ratio, respectively.

We adhered to the arbitrary categorization of telomere trajectories as previously reported: shortening was defined as a >10% decrease in RTL, stable as a ≤10% change in RTL and elongation as a >10% increase in RTL at T3 compared to baseline 17, 18 .

Other measurements and definitions

All participants completed a questionnaire regarding demographic profile and smoking habits. Smoking was categorized as current smoking, previous smoking and nonsmoking. Body mass index (BMI) was calculated as weight (kg) divided by height squared (m 2 ) and categorized as follows: normal, <25 kg m −2 overweight, 25–30 kg m −2 and obese, ≥30 kg m −2 . Hypertension was defined as systolic blood pressure ≥140 mmHg, diastolic blood pressure ≥90 mmHg or the use of antihypertensive medication prehypertension was defined as systolic blood pressure <140 and ≥120 mmHg and diastolic blood pressure <90 and ≥80 mmHg and normotension was defined as both systolic blood pressure <120 mmHg and diastolic blood pressure <80 mmHg. Diabetes was defined as a fasting plasma glucose level of ≥126 mg dL −1 (7.0 mmol L −1 ), a nonfasting plasma glucose level of ≥200 mg dL −1 (11.1 mmol L −1 ) or the use of oral antidiabetic agents. Hypercholesterolaemia was defined as a total cholesterol level of ≥250 mg dL −1 (6.5 mmol L −1 ) or the use of lipid-lowering medication ≤200 mg dL −1 (5.13 mmol L −1 ) was considered an optimal cholesterol concentration. Estimated glomerular filtration rate (eGFR) was calculated using the Modification of Diet in Renal Disease (MDRD) study equation taking into account sex, age, ethnicity and serum creatinine levels 19 . Details of the measurement methods can be found in the Appendix S1.

Análisis estadístico

To obtain a normal distribution, telomere length was natural-log-transformed. Other continuous variables with a skewed distribution (creatinine, insulin, glucose, high-sensitivity C-reactive protein, cholesterol, HDL and triglycerides) were also natural-log-transformed prior to analysis. Individuals in the bottom and top 0.5% of the RTL distribution were excluded to limit the undue influence of outliers in the regression analysis. Differences in telomere lengths between groups were tested using Student's t-test or one-way anova . Cross-sectional associations between variables and telomere length were evaluated using standard linear regression models. Multivariate linear regression models were used to adjust for age and gender. To investigate telomere dynamics across time, two-level hierarchical growth models were constructed. Variables were centred around the grand mean (i.e. the mean was set to zero). Details of the model-building strategy, centring and multitest correction are provided in the Appendix S1.


Conclusiones

Numerous observational studies of TL have been conducted among breast cancer patients in the last 20 years. Despite the major methodologic differences between studies, when considering all the studies (peripheral blood and tumor tissue) and all outcomes together, there was a trend toward an association of longer telomeres with a better prognosis. Further longitudinal studies with rigorous methodology, including proper control of confounding and an adequate TL measurement method, are still needed to determine the exact prognostic significance of TL for breast cancer patients.