Información

¿Cuál es la diferencia entre mutación por par de bases y mutación por genoma?

¿Cuál es la diferencia entre mutación por par de bases y mutación por genoma?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

¿No se considera que el tamaño del genoma es el número de pares de bases presentes en el ADN? Entonces, ¿cuál es la diferencia entre la mutación por par de bases y la mutación por genoma? ¿Son similares o diferentes?


Son diferentes normalizaciones del mismo número. Es la cuestión de si desea saber cuántas mutaciones se pueden esperar en una sola posición en un genoma, o si desea saber cuántas mutaciones ocurren en todo el genoma.

Ver wikipedia, por ejemplo:

Hay varias unidades naturales de tiempo para cada una de estas tasas, y las tasas se caracterizan como mutaciones por par de bases por división celular, por gen por generación o por genoma por generación.

Las mutaciones por genoma es el número de mutaciones por par de bases multiplicado por el número de pares de bases en el genoma (más las mutaciones que no corresponden a sustituciones de pares de bases, aunque generalmente se ignoran en estas mediciones).

P.ej., $10^{-9}$ mutaciones por par de bases en un genoma de 3 mil millones de pares de bases corresponden a $3$ mutaciones por genoma.


Tasa de mutación

En genética, la tasa de mutación es una medida de la velocidad a la que se producen varios tipos de mutaciones durante una unidad de tiempo. Las tasas de mutación se dan típicamente para una clase específica de mutación, por ejemplo, mutaciones puntuales, inserciones o deleciones a pequeña o gran escala. La tasa de sustituciones se puede subdividir en un espectro de mutación que describe la influencia del contexto genético en la tasa de mutación.

Hay varias unidades naturales de tiempo para cada una de estas tasas, y las tasas se caracterizan como mutaciones por par de bases por división celular, por gen por generación o por genoma por generación. La tasa de mutación de un organismo es una característica evolucionada y está fuertemente influenciada por la genética de cada organismo, además de una fuerte influencia del medio ambiente. Los límites superior e inferior a los que pueden evolucionar las tasas de mutación son objeto de una investigación en curso.


Estimación de la tasa de mutación por par de bases en la levadura Saccharomyces cerevisiae

Aunque las tasas de mutación son un determinante clave de la tasa de evolución, son difíciles de medir con precisión y las tasas de mutaciones globales (mutaciones por genoma por generación) a menudo se extrapolan de la tasa de mutación por par de bases asumiendo que la tasa de mutación es uniforme en todo el genoma. . Usando levadura en ciernes, describimos un método mejorado para el cálculo preciso de las tasas de mutación basado en el ensayo de fluctuación. Nuestro análisis sugiere que las tasas de mutación por par de bases en dos genes difieren significativamente (3.8031010aURA3y 6.4431010aCAN1) y proponemos una definición del tamaño objetivo efectivo de genes (la probabilidad de que una mutación inactive el gen) que reconoce que la tasa de mutación no es uniforme en todo el genoma.

evolución. Limita la velocidad de adaptación en poblaciones con mutaciones beneficiosas en ausencia de mutaciones beneficiosas establece la aptitud de equilibrio de la población. A pesar de su importancia, existen grandes incertidumbres en las estimaciones de la tasa de mutación del genoma por generación. La estimación de este parámetro es típicamente un proceso de tres pasos: determinar la tasa de mutación a un fenotipo particular, convertir esta tasa fenotípica en una tasa de mutación por par de bases en un gen particular, y extrapolar esta tasa local a la totalidad genoma. En este artículo nos centramos en el desafío técnico de determinar con precisión las tasas de mutación fenotípica y la tarea analítica de determinar el tamaño objetivo efectivo de un gen, la probabilidad de que una mutación en algún lugar de un segmento definido del genoma produzca una mutación con un efecto fenotípico específico.

Normalmente se emplean tres métodos para medir las tasas de mutación fenotípica: acumulación de mutaciones como se dice, acumulación de mutantes como se dice y ensayos de fluctuación. El ensayo de acumulación de mutaciones implica pasar un cultivo a través de cuellos de botella recurrentes, idealmente de una sola célula / individuo, de modo que todas las mutaciones son casi neutrales. Esto es útil para determinar la tasa de mutaciones que afectan la aptitud, ya que los cuellos de botella repetidos reducirán el efecto de la selección (Kibota y Lynch 1996 Zeyl y Devisser 2001). Este método funciona bien en organismos multicelulares, donde el tamaño de la población se puede mantener en el cuello de botella; sin embargo, en los microorganismos, donde se debe permitir que se forme una colonia visible, la selección seguirá ocurriendo entre los cuellos de botella. Varios

Hay métodos disponibles para estimar las tasas de mutación fenotípica a partir de ensayos de mutación-acumulación-mutación (García-Dorado y Gallego 2003). -Liautardet al.2007).

En el ensayo de acumulación de mutantes, la frecuencia de un fenotipo que es neutro en el entorno del experimento pero que puede seleccionarse en un entorno alternativo se controla en un cultivo de crecimiento exponencial colocando periódicamente una alícuota del cultivo en un medio selectivo. . Una vez que la población alcanza un tamaño tal que la probabilidad de que ocurra una nueva mutación en la próxima generación es aproximadamente uno, la frecuencia de mutantes aumentará linealmente con el tiempo. Por lo tanto, una estimación precisa de la tasa de mutación fenotípica requiere largos intervalos entre las mediciones de frecuencia y estos experimentos suelen durar cientos de generaciones. Debido a que la mayoría de la población no ha acumulado la mutación neutra, las mutaciones beneficiosas ocurrirán predominantemente en células que carecen de la mutación neutra, lo que ralentizará la acumulación de mutantes.

En el ensayo de fluctuación, muchos cultivos paralelos se inoculan con un pequeño número de células, se cultivan en condiciones no selectivas y se cultivan en placas para seleccionar mutantes (Luria y Delbru¨ ck1943). El número de mutaciones que surgen en cada cultivo seguirá la distribución de Poisson; sin embargo, el número de células mutantes por cultivo variará enormemente, ya que las mutaciones tempranas darán lugar a "premios gordos", cultivos que contienen una gran cantidad de individuos mutantes.

La forma más sencilla de estimar el número esperado de mutaciones que ocurren en cada cultivo (m) es a partir de la fracción de cultivos con cero mutantes, que debería ser em. Este método (

P0) fue utilizado por Luria y Delbru¨ ck (1943) en su artículo original que describe la fluctua-1Autor correspondiente:Departamento de Biología Molecular y Celular,

Universidad de Harvard, 16 Divinity Ave., Room 3000, Cambridge, MA 02138. Correo electrónico: [email protected]

ensayo de ionización. La distribución completa de mutantes por cultivo (la distribución Luria-Delbru¨ ck) puede describirse mediante un conjunto de ecuaciones recursivas (Maet al. 1992). El método más preciso para estimarm (máxima verosimilitud de Ma-Sandri-Sarkar) encuentra los que dan el mejor ajuste de la distribución de Luria-Delbru¨ck a los datos (Sarkar et al. 1992, Rosche y Foster 2000). Por simulación, Stewart (1994) calcula intervalos de confianza del 95% para los obtenidos con este método; sin embargo, para que los intervalos de confianza sean significativos, los datos deben seguir la distribución de Luria-Delbru¨ ck.

Una forma de estimar la calidad de los datos es trazar la distribución acumulativa de las frecuencias mutantes en un diagrama log-log.Luria-Delbru¨ck distribuidos los datos presentados de esta manera producirán una línea recta con pendiente 1 (Rosche y Foster 2000). Las desviaciones de la linealidad muestran que los datos no se aproximan a una distribución Luria-Delbru¨ck. Este enfoque gráfico ignora los premios gordos (ya que se encuentran lejos de la línea) y las culturas con cero mutantes (debido a la transformación logarítmica). En este artículo presentamos un enfoque basado en simulación para determinar la calidad de los datos de los ensayos de fluctuación y mostramos cómo este método puede detectar desviaciones de la distribución de Luria-Delbru¨ ck.

Para convertir las tasas de mutación fenotípica en una tasa de mutación por par de bases, necesitamos estimar el tamaño objetivo efectivo para la mutación fenotípica. Aunque el concepto de tamaño objetivo efectivo es importante en la teoría evolutiva (vincula la tasa de mutación a un fenotipo particular con la tasa de mutación por genoma por generación), no se ha definido explícitamente. En trabajos anteriores se ha utilizado "tamaño objetivo" para referirse al tamaño del gen en el que se seleccionan las mutaciones (Drake1991), pero también podría describir el número de mutaciones detectables dentro de un reportero. Proponemos una definición más general y probabilística del tamaño objetivo efectivo que abarca la relación entre las tasas de mutación fenotípica y genómica. Nuestra definición ilustra dónde surgen las incertidumbres en las estimaciones de la tasa de mutación genómica y muestra cómo se puede calcular este parámetro a partir de datos experimentales. En particular, distinguimos entre el tamaño objetivo efectivo basado en la tasa de mutación promedio por genoma y el tamaño objetivo efectivo específico del locus condicionado por un evento de mutación en una región específica del genoma.

Medimos las tasas de mutación de la resistencia al ácido 5-fluoroorótico (5-FOA), canavanina y factor a. El 5-FOA no es tóxico, pero se puede convertir en 5-fluoro-uracilo tóxico por la vía de biosíntesis del uracilo. El producto del gen URA3 cataliza un paso clave en este proceso, por lo tanto, 5-FOA selecciona predominantemente mutantes con pérdida de función de forura3. La canavanina es un análogo de arginina tóxico, cuya absorción requiere el transportador de arginina. Canavanine selecciona mutantes de pérdida de función de este transportador, que está codificado por el gen CAN1. El factor a es una feromona peptídica secretada por las células de tipo apareamiento (MATa). Unión de la feromona al receptor Ste2 en

aMATacell envía señales a través de una cascada de MAP-quinasa para iniciar los genes de respuesta de apareamiento y una detención de G1 (Dohlman

2002). Las células MATa de tipo salvaje secretan una proteasa, Bar1, que elimina el factor degradesa BAR1 evita el crecimiento en un medio que contiene factor α y nos permite medir la tasa de resistencia al factor α mediante el ensayo de fluctuación. Hay al menos 10 genes cuya pérdida de función resulta en resistencia a un factor a, por lo tanto, esperamos que la tasa de mutación a la resistencia al factor a sea un orden de magnitud mayor que la tasa de mutación a la resistencia a 5-FOA y canavanina. Encontramos que las tasas de mutación fenotípica a 5-FOA, canavanina y resistencia al factor and son 5.43 3108, 1.52 3 107y 3.07 3 106/ genoma / generación, respectivamente. Combinando nuestras estimaciones de las tasas de mutación fenotípica y los tamaños de diana efectivos específicos del locus, llegamos a la conclusión de que las tasas de mutación por par de bases enURA3 yCAN1 son 3.8031010y 6.4431010/ bp / generation, respectivamente, lo que sugiere que la tasa de mutación varía a lo largo del genoma de la levadura.

Cepas y medios: GIL104 es una cepa de levadura haploide derivada del fondo W303 con genotipoURA3, leu2, trp1, CAN1, ade2, his3, bar1DTADE2, MATa. La levadura se cultivó en

medio sintético completo (SC) (Shermanet al.1974), SC

medio sin uracilo (SCUra), o medio SC con solo 1% de glucosa (SCLG). Los cultivos que componían los ensayos de fluctuación se sembraron en cuatro tipos de medios selectivos: 13

medio canavanina½SC sin arginina (SCArg), 60 mg / litro / canavanina (Sigma-Aldrich, St. Louis) 103canavanina

(SCArg, 0,6 g / litro l-canavanina) 5-FOA½SCUra, 1 g / litro

5-FOA (Sigma-Aldrich) y extracto de levadura de factor ½, peptona, dextrosa (YPD), factor 10 mg / mla (Bio-Synthesis, Lewisville, TX). En preparación para la siembra en placa de varias manchas de cultivos mutantes en cada placa, las placas se secaron en exceso presionando un papel de filtro Whatman (grado 3, 90 mm) sobre las placas, utilizando un bloque de placa de réplica y permitiendo que el filtro permaneciera en su lugar durante al menos por lo menos 30 min. Los filtros eliminan 1 ml de líquido y las placas se pueden usar durante varios días después de quitar los filtros.

Ensayos de fluctuación: se realizaron ensayos de fluctuación en 10 clones de GIL104 para determinar la velocidad a la que las células mutaron para volverse resistentes a 5-FOA, 103 canavanina, ora-factor. Los medios y los volúmenes de cultivo se eligieron de manera que se contara un número similar de mutantes para cada fenotipo: 200 ml de SC, 100 ml de SC y 10 ml de SCLG para la resistencia a 5-FOA, 103canavanina y factor anda, respectivamente.

(seis puntos por placa) se colocaron cultivos de 100 ml en ocho placas de 103 canavanina (nueve puntos por placa) y los cultivos de 10 ml se llevaron hasta 100 ml con agua estéril y se colocaron en ocho placas de factor a (nueve puntos por placa) ). Se utilizó un manipulador de líquidos Tecan Genesis (Tecan U.S., Durham, NC) para semiautomatizar el enchapado puntual. Suponemos que la pérdida de células mutantes debido a la evaporación, la manipulación de líquidos y la eficiencia de la siembra incompleta es insignificante. En las condiciones utilizadas, el número medio de células por cultivo fue 2,13107, 1.33107, y 3,8 3 105, para 5-FOA, 103 canavanina, y a-factor, respectivamente.

Las placas se dejaron secar durante la noche a temperatura ambiente y luego se incubaron a 30 ° durante 1, 2 o 5 días para factor de concentración, 103

canavanina y 5-FOA, respectivamente, después de lo cual se contó el número de mutantes por mancha usando un microscopio de disección. Para las placas de 103 canavanina y factor y usamos un umbral de tamaño: se presumió que las colonias, 1 mm a 103 aumentos para la canavanina o 3 mm a 63 aumentos para un factor de canavanina eran el resultado de mutaciones que habían ocurrido después de que las células se sembraron y no se contaron. La elección del límite de tamaño se basó en buscar una ruptura natural en la distribución del tamaño de la colonia. Sin embargo, la distribución del tamaño de las colonias no fue bimodal, por lo tanto, es razonable suponer que se excluyeron algunos mutantes con fugas. Esto queda claro cuando observamos botes de mutantes menores que nuestro umbral de tamaño, que fueron excluidos del análisis. Por esta razón, es importante que las cepas que secuenciamos para determinar el tamaño de la diana se eligieron de las placas de los ensayos de fluctuación de modo que cualquier mutante con fugas, que se excluyó de la determinación de las tasas de mutación, también se excluyó del cálculo de tamaño objetivo. Los ensayos de fluctuación para la resistencia a la canavanina 13 se realizaron de manera similar a los de la canavanina 103, excepto que 13

Las placas de canavanina se contaron 3 días después de la siembra.

Análisis de los datos de fluctuación: los datos de fluctuación se analizaron mediante el método de máxima verosimilitud de Ma-Sandri-Sarkar en el que los datos se ajustan a un modelo de la distribución Luria-Delbru¨ ck sobre la base de un solo parámetro, el número esperado de mutación eventos por cultura (Sarkaret al. 1992).

La tasa de mutación se calcula a partir de la ecuación m¼m / N, donde N es el número medio de células por cultivo (aproximadamente igual al número de divisiones celulares por cultivo, ya que el inóculo inicial es mucho menor que N). Se asignaron intervalos de confianza del noventa y cinco por ciento onmandm utilizando las ecuaciones 29 y 30 de Foster (2006).

Los datos también se ajustaron a un modelo de dos parámetros que representa el crecimiento posterior a la placa. Este modelo es un Luria–

La distribución de Delbru¨ ck superpuesta con una distribución de Poisson con una tasa Nmd¼md, donde es el número medio de divisiones celulares (en las que se pueden producir y detectar mutantes) en el linaje de células que se colocaron en placas selectivas, que puede relacionarse con el número de generaciones de crecimiento posterior a la placa (g) byd¼ 2g 1. La distribución de probabilidad para el número de mutantes

por cultivo en el modelo de dos parámetros es, por lo tanto, la distribución conjunta de Luria-Delbru¨ck (parámetro m) y Poisson (parametern¼md) son iguales asumiendo que la tasa de mutación es la misma para las divisiones de células posteriores a la placa.

Usamos dos pruebas para evaluar si los modelos de uno o dos parámetros se ajustaban mejor a los datos. Ambos se basaron en calcular la probabilidad de recuperar los datos observados dado el modelo. Esta probabilidad, Pj, dondej es el número de parámetros en el modelo, se calculó como Pj ¼Pmax

N i donde pi es la probabilidad de observar mutantes y N es el número de cultivos independientes que producen colonias de mutantes. La prueba logarítmica de la razón de verosimilitud calcula L¼2 (log (P2) log (P1)),

que se distribuye como x2-distribución con 1 d.f. De Akaike El criterio de información (AIC) calcula el parámetro AIC¼ 2j2 (log (Pj)) y afirma que el mejor ajuste es el que tiene el valor de AIC más bajo. La prueba F no es apropiada para estas comparaciones ya que asume un modelo lineal con errores que se extraen de la misma distribución normal en cada punto de datos, ambos supuestos que son violados por los datos generados a partir de ensayos de fluctuación.

Secuenciación de mutantes ura3 y can1: la Tabla 1 enumera los cebadores que se utilizaron para amplificar y secuenciar los alelos theura3 y can1 de 5-FOA y 103 colonias resistentes a canavanina, respectivamente. Antes del aislamiento del ADN genómico, las colonias resistentes a 5-FOA y 103canavanina se volvieron a sembrar en medio selectivo.

Análisis computacional: El análisis de máxima verosimilitud Ma – Sandri – Sarkar y el ajuste de dos parámetros se realizaron en Matlab (MathWorks, Natick, MA). El ajuste al modelo de dos parámetros se logró optimizando m (withd fijo), optimizando d (withmfixed) y repitiendo este proceso hasta la convergencia. Se utilizó AIC para determinar qué modelo se ajusta mejor a los datos (Akaike 1974). Matlab también se utilizó para

datos de fluctuación simuladas, calculando las diferencias de suma de cuadrados entre las distribuciones y datos de Luria-Delbru¨ ck, y estimaciones de correas de botas de tamaños de objetivos efectivos para generar intervalos de confianza del 95%. Los archivos de Matlab para la mayoría de estas operaciones están disponibles en http://murraylab.mcb.harvard.edu/fluctuation/ programmes.htm.

Primers usados ​​en este estudio

Nombre del cebador Secuencia Propósito

URA3extF 59ATCAAAGAAGGTTAATGTGG 39 PCR

URA3extR 59TCATTATAGAAATCATTACG 39 PCR / secuenciación

URA3extF3 59TTGATTCGGTAATCTCCGAG 39 Secuenciación

Secuenciación URA3intF2 59TGGGCAGACATTACGAATGC 39

URA3intR2 59CAAACCGCTAACAATACCTG 39 Secuenciación

CAN1extF2 59TCTTCAGACTTCTTAACTCC 39 PCR

CAN1extR2 59ATAGTAAGCTCATTGATCCC 39 PCR / secuenciación

CAN1ext / intF1 59AAAAAAGGCATAGCAATGAC 39 Secuenciación

CAN1intF2 59GACGTACAAAGTTCCACTGG 39 Secuenciación

CAN1intF3 59TCAAAGAACAAGTTGGCTCC 39 Secuenciación

CAN1intR2 59TAGATGTCTCCATGTAAGCC 39 Secuenciación

Ensayos de fluctuación y tasas de mutación fenotípica:

La precisión de las estimaciones de la tasa de mutación de los ensayos de fluctuación depende de cómo se realiza el experimento y cómo se analizan los datos. Hemos realizado mejoras en ambos y los consideramos uno por uno.

Realización de ensayos de fluctuación: una forma de aumentar la precisión de las estimaciones de la tasa de mutación a partir de los ensayos de fluctuación es aumentar el número de cultivos (Stewart 1994). Por lo general, los ensayos de fluctuación se realizan en tubos de ensayo; sin embargo, para aumentar el rendimiento, realizamos los ensayos en placas de 96 pocillos. Placa 72 de los cultivos en medio selectivo para determinar el número de mutantes por cultivo, los 24 restantes se utilizan para determinar el número medio de células por cultivo (ver materiales y métodos). Usando el formato de 96 pocillos podemos variar

el volumen de cultivo de 10 a 200 ml y puede medir tasas de mutación en dos órdenes de magnitud (Tabla 2). En lugar de esparcir los cultivos en medios selectivos, colocamos los cultivos en placas sobre secadas, donde se extienden uniformemente sobre un área de 1,3 a 3 cm2., dependiendo en el volumen manchado. Esto aumenta la eficiencia y reduce el número de placas, ya que se pueden colocar hasta nueve cultivos en una placa.

La combinación de placas puntuales y el formato de 96 pocillos permiten la automatización del ensayo de fluctuación. Para demostrar esto, semiautomatizó el proceso utilizando un manipulador de líquidos, lo que nos permitió realizar todos los ensayos de fluctuación descritos aquí, el equivalente a tres ensayos de fluctuación de 720 tubos, en paralelo.

Análisis de datos de fluctuación y crecimiento posterior a la placa en 13

canavanina: Existen muchos métodos para calcular las tasas de mutación a partir de los datos de fluctuación (Foster 2006), de los cuales se prefiere el método de máxima verosimilitud de Ma-Sandri-Sarkar porque es el más preciso, es

válido para cualquier rango del número esperado de eventos de mutación por cultivo (m), y los intervalos de confianza del 95% pueden calcularse mediante un conjunto de ecuaciones determinadas empíricamente (Stewart 1994 Rosche y Foster 2000). Para que las estimaciones de las tasas de mutación y los intervalos de confianza del 95% generados a partir de este método sean precisos, los datos deben aproximarse a la distribución de Luria-Delbru¨ck. Probamos esta aproximación utilizando el método de máxima verosimilitud de Ma-Sandri-Sarkar para estimar y luego trazar la distribución de frecuencia acumulada predicha de mutantes contra los datos experimentales. Los ensayos de fluctuación en 5-FOA produjeron una estrecha concordancia entre las distribuciones predichas y observadas (Figura 1). En contraste, los análisis de 13 canavanina y factor a produjeron datos que se desviaron significativamente de la distribución Luria-Delbru¨ ck. En comparación con la distribución esperada, los cultivos con un pequeño número de mutantes están subrepresentados y los cultivos con muchos mutantes están sobrerrepresentados en el experimento de 13canavanina (Figura 1, modelo de un parámetro). Esta desviación puede explicarse como la combinación de una distribución Luria-Delbru¨ ck y una distribución de Poisson.

Una posible explicación es que las células sensibles a la canavanina pueden dividirse y dar lugar a mutaciones resistentes a la canavanina después de haber sido colocadas en placa, el número de colonias mutantes adicionales seguirá la distribución de Poisson. Ajustamos la distribución de las frecuencias mutantes a un modelo de dos parámetros que incorpora el crecimiento y la mutación posteriores a la placa. Este modelo es la distribución conjunta de una distribución Luria-Delbru¨ ck (con parámetrom) y una distribución de Poisson (con param-etern¼md). Los datos de 13canavanina se ajustaron mejor al modelo de dos parámetros (Figura 1).

Cuantificamos la mejora del ajuste mediante dos métodos. La primera es comparar la mejor probabilidad logarítmica

Tasas de mutación fenotípica

Tasa de mutación (mutaciones / genoma / generación)

A 5,51 (4,31–6,82) 2,08 (1,67–2,51) 6,49 (4,89–8,24)

B 5,51 (4,31–6,81) 1,81 (1,44–2,20) 4,77 (3,53–6,15)

C 6,28 (4,96–7,70) 2,21 (1,77–2,69) 7,19 (5,49–9,07)

D 6,58 (5,23–8,04) 1,88 (1,51–2,29) 5,08 (3,73–6,58)

E 5,60 (4,40–6,90) 2,06 (1,66–2,50) 4,48 (3,25–5,85)

F 6,07 (4,81–7,44) 1,87 (1,49–2,28) 6,70 (5,10–8,45)

G 5,35 (4,21–6,59) 1,76 (1,41–2,14) 4,74 (3,50–6,12)

H 6,05 (4,79–7,42) 2,05 (1,65–2,49) 5,01 (3,69–6,47)

I 6,00 (4,76–7,36) 1,79 (1,43–2,17) 7,03 (5,33–8,90)

J 5,50 (4,35–6,76) 2,09 (1,67–2,55) 3,05 (2,11–4,11)

Promedio 6SD 5.8560.41 1.9660.16 5.4561.34

Combinado 5,86 (5,46–6,28) 1,95 (1,83–2,08) 5,43 (4,97–5,91)

Tasas de mutación de la resistencia al factor a, resistencia a la canavanina (CanR) y resistencia al ácido 5-fluoroorótico (5-FOAR) para 10 clones de GIL104. Los paréntesis indican los intervalos de confianza del 95% calculados mediante ecuaciones 29 y 30 de Foster (2006). El conjunto de datos combinados trata los 10 ensayos de fluctuación de 72 tubos como un solo tubo de 720

calculado bajo modelos de uno y dos parámetros. Siempre que se utilice una gran cantidad de cultivos, se distribuye el doble de la diferencia entre las mejores puntuaciones de uno y dos parámetros ½L¼2 (log (P2 Param) log (P1 Param)

asx2con 1 d.f. Esto significa que si el mejor parámetro de dos el puntaje es .1.92 unidades logarítmicas mejor que el mejor puntaje de un parámetro, la probabilidad es.0.95 de que el modelo de dos parámetros se ajuste mejor a los datos. El segundo método fue utilizar el AIC, que utiliza tanto la probabilidad logarítmica como el número de parámetros al calcular una puntuación para encontrar el modelo que mejor se ajusta a los datos. Ambos se describen con más detalle en materiales y métodos.

Para los ensayos de fluctuación en 13canavanina, tanto la prueba de razón logarítmica de verosimilitud como la AIC indican que los datos se ajustan mejor mediante el modelo de dos parámetros. Para los ensayos de fluctuación en 5-FOA, no hay mejora de ajuste utilizando el modelo de dos parámetros. Para minimizar la mutación posterior a la placa, aumentamos la concentración de canavanina 10 veces y contamos las placas 1 día antes. Los datos de 103 canavanine se aproximan más a la distribución Luria-Delbru¨ck (Figura 1). Aunque el modelo de dos parámetros todavía ofrece un ajuste ligeramente mejor, según la prueba de la razón logarítmica de verosimilitud y el AIC, los datos se ajustan mejor mediante el modelo de un parámetro. Para el ensayo de fluctuación en un factor, los datos se ajustan mejor mediante el modelo de dos parámetros; sin embargo, ambos modelos no capturan todas las características de esta distribución (Figura 1). Tasas de mutación fenotípica: se realizaron ensayos de fluctuación para determinar las tasas de mutación al factor a, 103

canavanina y resistencia a 5-FOA para 10 clones isogénicos de una cepa del fondo W303 (GIL104), los datos se analizaron utilizando los modelos de un parámetro y dos parámetros (Tablas 2 y 3, respectivamente). Para cada ensayo, se aplicaron la prueba de razón logarítmica de verosimilitud y el AIC para determinar qué modelo se ajustaba mejor a los datos.

(Tabla 3). Todos los ensayos de fluctuación en el factor a se describen mejor mediante el modelo de dos parámetros, mientras que todos los ensayos de fluctuación en el 5-FOA se describen mejor mediante la distribución de Luria-Delbru¨ck (el modelo de un parámetro). Para 103 canavanina, cinco ensayos de fluctuación de acuerdo con la prueba de razón logarítmica de verosimilitud, o seis de acuerdo con el AIC, se ajustan mejor mediante el modelo de dos parámetros.

Utilizando los datos combinados de los 10 clones (efectivamente un ensayo de fluctuación con 720 cultivos paralelos) y el modelo de dos parámetros, determinamos las tasas de mutación fenotípica del factor α, la resistencia a la canavanina 103 y la 5-FOA en 3,073 106, 1.52 3 107y 5.43 3 108, respectivamente. Para la resistencia de 5-FOA, los datos son los mejores descrito por el modelo de un parámetro (d¼0 para el modelo de dos parámetros, lo que significa que el crecimiento y la mutación posteriores a la placa no ocurren) por lo tanto, podemos usar las ecuaciones 29 y 30 de Foster (2006) para asignar un intervalo de confianza del 95% a nuestra estimación. de la tasa de mutación. Esto produce un intervalo de confianza de 4.97–5.913108por generación (Tabla 2). Para el modelo de dos parámetros, determinamos los intervalos de confianza mediante simulación. Para cada ensayo de fluctuación de cultivo combinado de 720, determinamos los valores más probables de formandd, dados los datos. Para medir la variación esperada en estos parámetros, simulamos 1000 ensayos de fluctuación muestreando la distribución combinada de Luria-Delbru¨ck / Poisson usando parámetros determinados a partir de los datos. Consideramos que los intervalos de confianza del 95% para nuestra estimación de m son los valores de m que abarcan el 95% de los experimentos simulados. A partir de esto, calculamos que los intervalos de confianza del 95% en el modelo de dos parámetros son 2,65–3,623 106, 1.34– 1.71 3 107y 4.78–5.87 3 108 por a-factor, 103 canavanina y resistencia a 5-FOA, respectivamente.

Espectros mutacionales y tamaño del objetivo: Espectros mutacionales: Queríamos convertir nuestras tasas de mutación fenotípica a la Figura 1. — Resultados de tres tubos de 72

ensayos de fluctuación utilizando el clon A de GIL104 en placa sobre 13canavanina, 5-FOA, 103

canavanina y factor a. Los círculos sólidos muestran la distribución acumulativa de los datos. Las curvas sólidas indican las distribuciones acumuladas de Luria-Delbru¨ck (modelo de un parámetro) que se ajustan a los datos con el parámetro m¼4.80, 1.31, 2.82 y 1.97 para 13 can-avanina, 5-FOA, 103 canavanina y factor a , respectivamente. La curva sombreada gruesa es el modelo de dos parámetros de crecimiento posplacado ajustado a los datos con m = 2,31, d¼ 2,62 m¼ 2,39, d¼0,37 y m¼1,10 yd¼1,42 para 13canavanina y 103canavanina, respectivamente. Los modelos de un parámetro y dos de un parámetro son los mismos para 5-FOA. Usando el criterio de información de Akaike (Akaike 1974), el

tasas de mutación por par de bases. El material para esta conversión son los espectros mutacionales de los ensayos de fluctuación que secuenciamos 237ura3 alelos y 227can1 alelos de 5-FOA- y 103 cepas resistentes a la canavanina, respectivamente (la identidad de los 464 alelos mutantes está disponible en el complemento información en http: // www. genetics.org/supplemental/). Treinta mutantes resistentes a 5-FOA contienen alelos URA3 de tipo salvaje, 29 de estos mutantes son protótrofos de uracilo. Se ha informado que las mutaciones en FUR1 pueden conferir este fenotipo; sin embargo, no pudimos encontrar ninguna mutación dentro de la secuencia de codificación de este gen para ninguno de los 29 protótrofos de uracilo resistentes a 5-FOA (datos no mostrados). Ninguno de los 207 mutantes de ura3 es prototrófico y cada uno contiene una sola mutación o dos mutaciones en unas pocas mareas de nucleótidos. Hay sustituciones de 167 pb (64 sin sentido y 103 sin sentido), 22 deleciones de un solo pb, 3 deleciones de 2 pb, 3 inserciones de un solo pb, una inserción de 3 pb, dos grandes duplicaciones tan-dem y nueve mutaciones dobles (Figura 2). Los 227 103 mutantes resistentes a la canavanina contienen una sola mutación o mutaciones muy adyacentes en el locus CAN1. Encontramos sustituciones de 150 pb (70 sin sentido y 80 sin sentido), 55 deleciones de un solo pb, 8 inserciones de un solo pb, una inserción de 2 pb, 10 mutaciones dobles y 3 mutaciones complejas, incluido un alelo can1 que contiene una deleción de 27 pb y una duplicación en tándem de 30 pb (Figura 3).

Tasa de mutaciones sin sentido por par de bases: a partir de los resultados hasta ahora, podemos calcular la tasa de mutación por par de bases para mutaciones sin sentido en los genes CAN1 yURA3. Primero necesitamos corregir la tasa de mutación fenotípica a la resistencia a 5-FOA para tener en cuenta que solo 207 de

237 mutantes de 5-FOA son mutantes de URA3. Esto da como resultado una tasa de mutación para la pérdida de función de 4.753108por URA3 y 1.523 107porCAN1. Si multiplicamos estos tasas por la fracción de mutaciones sin sentido en los espectros mutacionales encontramos que las tasas de mutaciones sin sentido enURA3 yCAN1 son 1.473108y 4.693 108, respectivamente. ParaURA3yCAN1, contamos el número de posibles sustituciones sin sentido de las secuencias conocidas de estos genes. URA3 es 804 pb, por lo tanto, hay 2412 posibles sustituciones (804 pb33 posibles sustituciones por par de bases). De estos, 123 resultan en mutaciones sin sentido. Al dividir estas tasas por el número de posibles sustituciones sin sentido y multiplicarlas por 3, dado que hay 3 posibles mutaciones en cada base, encontramos que la tasa de mutación sin sentido normalizada por par de bases es 3.5831010porURA3y 6.213 1010porCAN1. Repitiendo el análisis anterior para los 10 ensayos de fluctuación en CAN1 y URA3 de la Tabla 3 encontramos que las tasas de mutación sin sentido por par de bases difieren significativamente en estos dos loci (suma de rangos de Wilcoxon, P, 1.833 104). Estos cálculos se realizaron con tasas de mutación del modelo de dos parámetros, corrigiendo el crecimiento posterior a la placa y la mutación en placas de canavanina. Si hubiéramos utilizado el modelo de un parámetro, la diferencia en las tasas de mutación entre URA3 y CAN1 habría sido mayor, ya que el modelo de un parámetro sobreestima las tasas de mutación fenotípica de la resistencia a la canavanina.

Definición de tamaño objetivo efectivo: definimos un tamaño objetivo para realizar dos cálculos: determinar la tasa de mutación genómica dados los experimentos que miden la tasa de mutación en un locus particular y predecir la tasa


1. INTRODUCCIÓN

Comprender los fundamentos genéticos de procesos como la adaptación y la especiación es un objetivo importante en la biología evolutiva. Esto requiere cuantificar el número de loci involucrados y su distribución en el genoma (por ejemplo, arquitectura genómica), así como el tipo de mutación y sus propiedades estadísticas asociadas. Recientemente se ha centrado en los tipos de mutaciones (p. Ej., SNP, translocaciones, inversiones) y en la literatura abundan discusiones detalladas sobre la importancia evolutiva de diferentes tipos de mutación (p. Ej., Choi & Lee, 2020 Faria et al., 2019 Katju & Bergthorsson, 2013). Sin embargo, la mayoría de estas revisiones, así como la mayoría de los estudios teóricos y empíricos, no examinan la gama completa de tipos de mutaciones. Para comprender la importancia evolutiva relativa de los diferentes tipos de mutación, debemos considerarlos simultáneamente en un marco integrado.

Desde un punto de vista evolutivo, las características más importantes de una mutación son su tasa de ocurrencia, sus efectos genéticos poblacionales y cómo estos pueden influir en los resultados evolutivos posteriores. Aquí, proponemos un marco de investigación que aprovecha décadas de investigación genética poblacional (Charlesworth y Charlesworth, 2010 Futuyma, 1986) para utilizar directamente los efectos genéticos poblacionales de diferentes tipos de mutación para determinar su importancia evolutiva relativa (Figura 1a). Consideramos que los efectos genéticos poblacionales son el impacto de una mutación en los parámetros genéticos poblacionales: tasa de recombinación, tamaño efectivo de la población, coeficientes de selección y dominancia (ver Figura 1c para una descripción general de los efectos genéticos poblacionales de cada tipo de mutación). Aunque otras características, como si una mutación afecta a las regiones reguladoras o codificadoras, también son importantes para la evolución (Hoekstra & Coyne, 2007), aquí nos concentramos en las características que pueden estar directamente relacionadas con el tipo de mutación.

Nuestro marco combina lo que llamamos el enfoque "hacia adelante" y el enfoque "inverso". A partir de la mutación, el enfoque hacia adelante caracteriza la frecuencia con la que ocurren diferentes tipos de mutaciones (Figura 1b) y sus efectos genéticos poblacionales (Figura 1c), con el fin de predecir su papel en diferentes resultados evolutivos. El enfoque inverso comienza con el resultado evolutivo y, utilizando datos empíricos, determina las contribuciones relativas de múltiples tipos de mutación de manera sistemática. Ya existe una gran cantidad de conocimiento sobre los efectos genéticos poblacionales de diferentes mutaciones (es decir, el enfoque hacia adelante Dobigny et al., 2017 Elena et al., 1998 Korunes & Noor, 2019 Malik, 2009). Por el contrario, pocos estudios examinan múltiples tipos de mutaciones simultáneamente utilizando el enfoque inverso. Por lo tanto, aquí nos concentramos en el enfoque hacia adelante.

Para delinear el enfoque hacia adelante, brindamos un resumen no exhaustivo de lo que se sabe sobre las tasas de mutación y los efectos genéticos poblacionales de las diferentes mutaciones, aprovechando el extenso cuerpo de trabajo existente (Choi & Lee, 2020 Faria et al., 2019 Katju Y Bergthorsson, 2013). Hacemos hincapié en que la cuantificación de estos efectos, la evaluación de las diferencias entre los tipos de mutación y la determinación de la distribución de los tamaños del efecto será un paso fundamental hacia adelante y sugerimos diferentes formas de lograrlo. Discutimos áreas donde se necesitan más datos empíricos, teoría y síntesis para el enfoque directo, y destacamos la importancia de aplicar el enfoque inverso.

1.1 Tasa de mutación

La tasa de mutación es un parámetro crítico cuando se investiga el impacto evolutivo de diferentes tipos de mutaciones. Puede medirse directamente, comparando el número de mutaciones en gametos, cigotos o descendencia (Fu y Huai, 2003). En el caso de los SNP, también se puede medir indirectamente mediante la comparación de datos de polimorfismos sinónimos (generalmente supuestos neutrales) dentro y entre especies estrechamente relacionadas. Las estimaciones de la tasa de mutación varían mucho entre taxones y tipos de mutación (Figura 1b). Sin embargo, las diferentes mutaciones varían con respecto a su detectabilidad (por ejemplo, es mucho más probable que los SNP se detecten con datos de secuenciación de lectura corta que con inserciones o deleciones más grandes [Ho et al., 2020]), lo que puede llevar a una subestimación de la tasa de mutación de diferentes mutaciones. Las nuevas metodologías pueden ayudar a mejorar este problema. Específicamente, los datos de lectura larga en combinación con otras metodologías como la secuenciación de lectura enlazada (Seo et al., 2016) y las técnicas de captura y secuenciación de cromatina como Hi-C (Wang et al., 2020) pueden facilitar la identificación de grandes variantes estructurales. (Christmas et al., 2019). Por lo tanto, dos pasos clave identificados por nuestro marco son (i) desarrollar nuevos métodos que permitan la detección simultánea de los diferentes tipos de mutación, y (ii) aumentar tanto el número como la amplitud taxonómica de estudios que estiman directamente las tasas de mutación y analizar múltiples tipos de mutación diferentes dentro del mismo taxón.


¿Cuál es la diferencia entre mutación por par de bases y mutación por genoma? - biología

Comprender las similitudes y diferencias entre las personas ocupa a psicólogos, antropólogos, artistas, médicos y, por supuesto, a muchos biólogos. Incluso cuando se enfoca solo en las diferencias genéticas entre las personas, hay una deslumbrante variedad de temas para discutir. El día en que el ADN extraído en la escena de un crimen puede conducir a un retrato de foto policial parece haber llegado ya, al menos según una publicación reciente sobre el modelado de formas faciales en 3D a partir del ADN (P. Claes et al, PLOS Genetics, 10: e1004224, 2014). En el espíritu de la biología celular por los números, ¿podemos obtener alguna intuición básica del análisis lógico de las implicaciones de algunos números clave que pertenecen a la cuestión de la diversidad genética en los seres humanos?

Comenzamos centrándonos en las diferencias de un solo par de bases, o polimorfismos (SNP). Otros componentes de variación como inserciones y deleciones, número variable de repeticiones de genes (parte de lo que se conoce como variaciones del número de copias o CNV) y elementos transponibles se abordarán a continuación. ¿Cuántas variaciones de un solo par de bases esperaría entre usted y una persona seleccionada al azar en la esquina de una calle? Los esfuerzos de secuenciación, como el proyecto de los 1000 genomas, nos dan una regla general. Encuentran alrededor de un SNP por 1000 bases. Es decir, dejando de lado otros componentes, la base de la afirmación de que las personas son genéticamente similares en un 99,9%. Pero esta similitud genética plantea la pregunta: ¿cómo es que nos sentimos tan diferentes de esa persona con la que nos encontramos en la calle? Bueno, sigue leyendo para conocer otras diferencias genéticas, pero también debes apreciar cómo nuestros cerebros están sintonizados para notar y amplificar las diferencias y dispensar las propiedades unificadoras, como que todos tenemos dos manos, una nariz, un cerebro grande, etc. . Para un extraterrestre, probablemente todos pareceríamos idénticos, al igual que puede ver dos ratones y si su abrigo de piel es el mismo, parecerían clones incluso si uno es el Richard Feynman de su clan y el otro el Winston Churchill.

Volvamos a los números. Comprobemos la precisión y las implicaciones de la regla de oro de un SNP por 1000 bases. El genoma humano tiene una longitud de aproximadamente 3 Gbp. Esto sugiere alrededor de 3 millones de SNP entre dos personas al azar. De hecho, este es el valor informado dentro del 10%, lo que no es de extrañar, ya que este es el origen de la regla empírica (BNID 110117).¿Qué más podemos decir sobre este número? Con aproximadamente 20.000 genes, cada uno de los cuales tiene una secuencia codificante (exones) de aproximadamente 1,5 kb de longitud (es decir, aproximadamente 500 aminoácidos de longitud de proteína en promedio), la secuencia codificante humana cubre 30 Mbp o aproximadamente el 1 por ciento del genoma. Si los SNP se distribuyeran aleatoriamente a lo largo del genoma, esto sugeriría alrededor de 30.000 SNP a lo largo de la secuencia de codificación del genoma, o poco más de 1 por secuencia de codificación de gen. El valor medido es de aproximadamente 20.000 SNP, lo que da una idea de lo equivocados que estábamos en nuestra suposición de que los SNP se distribuyen aleatoriamente. Entonces, estamos estadísticamente equivocados, ya que cualquier prueba estadística daría una probabilidad impresionantemente baja de que este valor más bajo aparezca por casualidad. Esto es probablemente una indicación de una selección purificadora más fuerte en las regiones codificantes. Al mismo tiempo, para nuestros términos prácticos, esta variación de menos de 2 veces sugiere que este sesgo no es muy fuerte y que el 1 SNP por gen es una regla práctica razonable.

¿Cómo se traduce esta distribución de SNP en cambios en los aminoácidos de las proteínas? Supongamos nuevamente una distribución homogénea entre las mutaciones que cambian de aminoácidos (no sinónimos) y aquellas que no afectan la identidad de los aminoácidos (sinónimos). A partir del código genético, el número de cambios no sinónimos cuando no hay selección o sesgo de ningún tipo debería ser aproximadamente cuatro veces mayor que el de mutaciones sinónimas (es decir, las mutaciones sinónimas son aproximadamente el 20% de las posibles mutaciones, BNID 111167). Esto se debe a que hay más sustituciones de bases que cambian un aminoácido que aquellas que mantienen la misma identidad de aminoácidos. ¿Qué encuentra uno en la realidad? En realidad, se encuentran alrededor de 10,000 mutaciones de cada tipo (BNID 110117), lo que muestra que, de hecho, existe un sesgo hacia la representación insuficiente de mutaciones no sinónimas, pero en nuestro orden de magnitud, la visión del mundo no es importante.

Sin embargo, un tipo de mutación que puede ser especialmente importante es la mutación sin sentido que crea un codón de parada que terminará la traducción antes de tiempo. ¿Con qué frecuencia podríamos esperar ingenuamente encontrar tales mutaciones dada la carga general de SNP? Tres de los 64 codones son codones de parada, por lo que esperaríamos groseramente 20.000 * 3/64 ≈ 1000 mutaciones de parada tempranas. Las observaciones muestran alrededor de 100 mutaciones sin sentido de este tipo, lo que indica un fuerte sesgo selectivo contra tales mutaciones. Aún así, nos parece interesante mirar a la persona que está a nuestro lado y pensar qué 100 proteínas en nuestros genomas están truncadas diferencialmente. Gracias a la naturaleza diploide de nuestros genomas, suele haber otra copia completamente intacta del gen (la situación se conoce como heterocigosidad) que puede servir de respaldo.

¿Qué tan diferente es tu genotipo de cada uno de tus padres? Suponiendo que tengan genotipos no relacionados, los valores anteriores deben reducirse a la mitad ya que comparte la mitad de los genomas de su padre y su madre. Así que todavía hay bastantes genes truncados y aminoácidos sustituidos. La situación con su hermano o hermana es cuantitativamente similar, ya que nuevamente comparte, en promedio, la mitad de sus genomas (asumiendo que no son gemelos idénticos…). En realidad, para aproximadamente 1/4 de su genoma, usted y su hermano son como gemelos idénticos, es decir, tienen las mismas dos copias parentales del ADN. Las inserciones y deleciones (apodadas indeles) de hasta aproximadamente 100 bases son más difíciles de enumerar, pero se observa un orden de magnitud de 1 millón por genoma, aproximadamente 3000 de ellas en regiones de codificación (por lo que una subrepresentación de aproximadamente la mitad de un orden de magnitud). Las variaciones más grandes de tramos más largos, incluidas las variaciones en el número de copias, se encuentran en decenas de miles por genoma, pero debido a que son tramos tan largos, su longitud sumada podría ser más larga que el número de bases en los SNP.

La capacidad de caracterizar de manera integral estas variaciones es un logro científico muy reciente, que comenzó solo en el tercer milenio con la carrera memorable entre los consorcios del proyecto del genoma humano y el grupo liderado por Craig Venter. Al comparar los resultados entre estos dos equipos, se encuentra que al comparar el genoma de Craig Venter con el de la secuencia de referencia del genoma humano de consenso, hay una diferencia de aproximadamente 1.2% cuando se consideran indeles y CNV, 0.1% cuando se consideran SNP: ≈ 0.3% cuando se consideran inversiones, un total general de 1.6% (BNID 110248). En la década que siguió a la secuenciación del genoma humano, las tecnologías avanzaban extremadamente rápido, lo que condujo al Proyecto 1000 Genomas que podría parecer un proyecto de rotación para algunos de nuestros lectores cuando leyeron estas palabras. Quién sabe qué tan pronto el lector podría verificar nuestros números citados cargando su genoma de su informe médico y compararlo con algún amigo al azar.


Conclusión

El mejoramiento por mutaciones ha sido durante mucho tiempo una herramienta beneficiosa no solo en la caja de herramientas del obtentor, sino también en la del genetista básico. En cultivos donde la diversidad para un rasgo dado es baja o inexistente, la mutagénesis inducida proporciona una vía de posibilidad. Con un objetivo claro, un protocolo mutagénico eficiente y un método de cribado fenotípico eficiente y de alto rendimiento, la mutagénesis puede ser de gran beneficio para la mejora de las plantas de cultivo.


¿Cuál es la diferencia entre mutación por par de bases y mutación por genoma? - biología

Las mitocondrias son "orgánulos" dentro de las células vivas que son responsables de producir la moneda de energía llamada ATP (trifosfato de adenosina), que todas las células necesitan para funcionar. Las mitocondrias llevan su propio ADN separado (ADNmt) que es independiente del ADN nuclear de la misma célula. El ADNmt humano está compuesto por 37 genes que suman aproximadamente 16.000 pares de bases. Este mtDNA también muta a un ritmo mucho más rápido que el del ADN nuclear (nucDNA). Se ha mapeado completamente el ADNmt humano y se conocen todas las regiones codificantes (así como las proteínas o ARN que codifican). Algunos de los mtDNA no codifica para nada (que se cree que hace que estas secciones sean inmunes a la "presión de selección natural"), y se conocen como las "regiones de control". Una región en particular parece mutar más rápido que cualquier otra región (1,8 veces más rápido), porque la variación entre los humanos es mayor aquí. 4 Cuando la célula se divide, cada célula se lleva parte de las mitocondrias. Las mitocondrias se replican de forma independiente dentro de la célula. Más allá de esto, se ha asumido generalmente que las mitocondrias siempre se transmiten de la madre a la descendencia sin estar involucradas con la mezcla genética y la recombinación del mtDNA con el mtDNA del padre. Recientemente, sin embargo, esta noción ha sido cuestionada. Resulta que se han detectado muchos casos de ADNmt de origen paterno en familias modernas de humanos y en otras especies. Considere los hallazgos de un interesante estudio publicado por Schwartz y Vissing en la edición de 2002 de la Revista de Medicina de Nueva Inglaterra:

"Se cree que el ADN mitocondrial de mamíferos (ADNmt) se hereda estrictamente de la madre. Las mitocondrias de los espermatozoides desaparecen en la embriogénesis temprana por destrucción selectiva, inactivación o dilución simple por el gran excedente de mitocondrias de ovocitos. . . El mecanismo subyacente responsable de la eliminación del ADNmt de los espermatozoides en embriones normales no se comprende bien. Especulamos que el proceso en algunos casos puede ser defectuoso, permitiendo que las mitocondrias de los espermatozoides sobrevivan y dando a las que tienen una ventaja selectiva la posibilidad de prevalecer en ciertos tejidos. . . Se han detectado cantidades muy pequeñas de ADNmt heredado por el padre mediante la reacción en cadena de la polimerasa (PCR) en ratones después de varias generaciones de retrocruces interespecíficos. Los estudios de tales híbridos y de ovocitos de ratón microinyectados con esperma apoyan la hipótesis de que las mitocondrias de los espermatozoides están dirigidas a la destrucción por proteínas codificadas en el núcleo. Presentamos el caso de un varón de 28 años con miopatía mitocondrial por una nueva deleción de ADNmt de 2 pb en el ND2 gen (también conocido como MTND2), que codifica una subunidad del complejo enzimático I de la cadena respiratoria mitocondrial. Determinamos que el mtDNA que alberga la mutación era de origen paterno y representaba el 90 por ciento del mtDNA del músculo del paciente ''. 47

Entonces, ¿qué significa tal hallazgo con respecto a las tasas de mutación del mtDNA y los relojes moleculares? Bueno, considere los siguientes comentarios de Morris y Lightowlers publicados en una edición de 2000 de La lanceta:

Generalmente se asume que el ADN mitocondrial (ADNmt) se hereda exclusivamente de la madre. Sin embargo, varios artículos recientes han sugerido que los elementos del mtDNA a veces pueden heredarse del padre. Esta hipótesis se basa en la evidencia de que el mtDNA puede sufrir recombinación. Si esto ocurre, el mtDNA materno en el huevo debe cruzarse con secuencias homólogas en una molécula de DNA diferente. El mtDNA paterno parece ser el candidato más probable. Si el mtDNA puede recombinarse, independientemente del mecanismo, existen importantes implicaciones para la evolución del mtDNA y para los estudios filogenéticos que utilizan mtDNA. 48

Antes de que se descubriera esta evidencia de herencia paterna, se suponía que el ADNmt era estrictamente el resultado de la herencia materna. Con base en esta suposición, se asumió que la descendencia mitocondrial obtendría copias exactas de las mitocondrias que tenía la madre, excepto si había un error mutacional. Se ha pensado durante mucho tiempo que esta tasa de error en la porción no codificante del ADN mitocondrial ocurre una vez cada 300 a 600 generaciones, o cada 6.000 a 12.000 años para los seres humanos.

Los bioquímicos de Berkeley que desarrollaron la teoría, Allan Wilson, Rebecca Cann y Mark Stoneking, hicieron varias suposiciones aparentemente razonables. Dado que no hubo cambios en el ADN debido a eventos de recombinación genética (es decir, con el ADN paterno, ahora se sabe que es una suposición incorrecta), asumieron que todos los cambios en el ADNmt eran el resultado de mutaciones a lo largo del tiempo y que estas mutaciones ocurrían de manera constante. índice. Sobre la base de estas suposiciones, los investigadores creían que tenían acceso a algo así como un `` reloj molecular ''. Debido a que se cree que el ADNmt muta más rápido que el ADN nuclear (ADNnu), se pensó que la tasa de mutación más rápida del ADNmt haría que el ADNmt fuera más preciso manteniendo el tiempo que nucDNA.

El estudio original de 1987 involucró ADNmt de 136 mujeres de muchas partes del mundo con diferentes antecedentes raciales. El análisis pareció respaldar la idea de una única molécula de ADNmt ancestral de una mujer que vivía en el África subsahariana hace unos 200.000 años. Posteriormente, estudios más detallados parecieron confirmar esta conclusión. Desafortunadamente, sin embargo, hubo un sesgo no detectado en el programa informático, así como en los propios investigadores. Los investigadores utilizaron un programa informático diseñado para revelar una filogenia de "máxima parsimonia" o el árbol genealógico con el menor número de cambios mutacionales. Esto se basó en la suposición de que la evolución habría tomado el camino más directo y eficiente (lo cual no es necesariamente cierto, ni siquiera probable). Además, el programa informático estaba sesgado por el orden de entrada de datos para favorecer la información introducida primero. Este problema se reconoció cuando la computadora dio resultados diferentes según el orden en que se ingresaron los datos. Ahora, después de miles de operaciones de computadora con los datos ingresados ​​al azar, parece que el "origen africano" para los humanos modernos no tiene una importancia estadística sobre otras posibilidades. 26

Los problemas con estos estudios eran tan graves que Henry Gee, miembro del equipo editorial de la revista, Naturaleza, describió duramente los estudios como "basura". Después de considerar el número de secuencias involucradas (136 secuencias de ADNmt), Gee calculó que el número total de árboles parsimoniosos potencialmente correctos supera los mil millones. 25 El genetista Alan Templeton (Universidad de Washington) sugiere que la mezcla de bajo nivel entre las primeras poblaciones humanas puede haber alterado las secuencias de ADN lo suficiente como para que la cuestión del origen de los humanos modernos y una fecha para "Eva" nunca pueda resolverse mediante el ADNmt. 22 En una carta a Ciencias, Mark Stoneking (uno de los investigadores originales) reconoció que la teoría de una "Eva africana" ha sido invalidada. 23

Otro aspecto interesante de la teoría del "reloj molecular" es la forma en que se determinó la tasa de mutación en sí. Al contrario de lo que muchos podrían pensar, la tasa de mutación no fue determinada inicialmente por ningún tipo de análisis directo, sino por supuestas relaciones evolutivas filogénicas entre humanos y chimpancés. En otras palabras, la tasa de mutación se calculó partiendo del supuesto de que la teoría en cuestión ya era cierta. Esta es una suposición bastante circular y, como tal, todos los resultados que se basan en esta suposición serán consistentes con esta suposición, como una profecía autocumplida. Dado que la tasa se calculó en base a supuestos previos del tiempo de evolución, los resultados automáticamente "confirmarán" los supuestos anteriores. Si uno realmente desea la confirmación independiente de una teoría, entonces no puede calibrar la prueba de confirmación por la teoría, o cualquier parte de la teoría, que se está probando. Y, sin embargo, esto es exactamente lo que hicieron científicos como Sarich, uno de los pioneros de la idea del reloj molecular. Sarich comenzó calculando las tasas de mutación de varias especies ". cuya divergencia podría datarse de manera confiable a partir de fósiles ''. Luego aplicó esa calibración a la división chimpancé-humano, que data de hace cinco a siete millones de años. Usando las calibraciones de mutación de Sarich, Wilson y Cann las aplicaron a sus estudios de ADNmt, comparando & quot. la proporción de divergencia del ADN mitocondrial entre humanos y entre humanos y chimpancés. "24 Mediante este método, calcularon que el antepasado común de todos los humanos modernos, la" Eva africana ", vivió hace unos 200.000 años.

Entonces, obviamente, estas fechas, calculadas a partir del análisis de ADNmt, deben coincidir con la escala de tiempo evolutiva presupuesta, ya que el cálculo se basa en esta presuposición. La circularidad de este método es incompatible con un buen método científico y no tiene ningún valor en lo que respecta al valor predictivo independiente. La teoría del "reloj mitocondrial" era y es básicamente una teoría dentro de una teoría en el sentido de que no tiene poder predictivo independiente fuera de la teoría de la evolución. Es sorprendente entonces que los científicos no hayan detectado antes este defecto inherente. Curiosamente, sin embargo, esta falla en el razonamiento no se detectó durante muchos años y tal vez no se hubiera detectado durante mucho más tiempo si no se hubiera realizado un análisis más directo de la tasa de mutación.

Finalmente, los científicos, que estudian las familias históricas y sus historias genéticas, comenzaron a cuestionar las tasas de mutación que se basaban en supuestos filogenéticos evolutivos. Estos científicos se sorprendieron al descubrir que la tasa de mutación era, de hecho, mucho más alta de lo que se pensaba. De hecho, era aproximadamente 20 veces mayor en aproximadamente una mutación cada 25 a 40 generaciones (alrededor de 500 a 800 años para los humanos). Parece que en esta sección de la región de control, que tiene alrededor de 610 pares de bases, los humanos típicamente se diferencian entre sí por alrededor de 18 mutaciones. 3 Por matemáticas simples, se deduce que los humanos modernos comparten un ancestro común unas 300 generaciones atrás en el tiempo. Si se asume un tiempo de generación típico de unos 20 años, esto sitúa la fecha del antepasado común en unos 6.000 años antes del presente. ¡¿Pero cómo podría ser esto ?! Thomas Parsons parece igualmente desconcertado. Considere sus siguientes comentarios publicados en abril de 1997, en la revista Genética de la naturaleza:

"La tasa y el patrón de sustituciones de secuencia en la región de control (CR) del ADN mitocondrial (ADNmt) es de importancia central para los estudios de la evolución humana y las pruebas de identidad forense. Aquí, informamos una medición directa de la tasa de sustitución intergeneracional en el CR humano. Comparamos las secuencias de ADN de dos segmentos hipervariables de CR de parientes maternos cercanos, de 134 linajes de ADNmt independientes que abarcan 327 eventos generacionales. Se observaron diez sustituciones, lo que resultó en una tasa empírica de 1/33 generaciones, o 2,5 / sitio / Myr. Esto es aproximadamente veinte veces más alto que las estimaciones derivadas de los análisis filogenéticos. Esta disparidad no puede explicarse simplemente por sustituciones en puntos calientes mutacionales, lo que sugiere factores adicionales que producen la discrepancia entre las tasas aparentes de divergencia de secuencia a muy corto y largo plazo. Los datos también indican que la segregación extremadamente rápida de variantes de secuencia CR entre generaciones es común en humanos, con un cuello de botella de ADNmt muy pequeño. Estos resultados tienen implicaciones para las aplicaciones forenses y los estudios de la evolución humana.

La tasa de sustitución observada que se informa aquí es muy alta en comparación con las tasas inferidas de los estudios evolutivos. Se ha derivado una amplia gama de tasas de sustitución de CR a partir de estudios filogenéticos, que abarcan aproximadamente 0,025-0,26 / sitio / Myr, incluidos los intervalos de confianza. Un estudio que arrojó una de las estimaciones más rápidas dio la tasa de sustitución de las regiones hipervariables CR como 0,118 + - 0,031 / sitio / Myr. Suponiendo un tiempo de generación de 20 años, esto corresponde a

1/600 generaciones y una edad para el mtDNA MRCA de 133.000 años. Por lo tanto, nuestra observación de la tasa de sustitución, 2,5 / sitio / Myr, es aproximadamente 20 veces mayor de lo que se podría predecir a partir de análisis filogenéticos. Usar nuestra tasa empírica para calibrar el reloj molecular del mtDNA daría como resultado una edad del mtDNA MRCA de solo

6.500 años, claramente incompatible con la edad conocida de los humanos modernos. Incluso reconociendo que el MRCA del mtDNA puede ser más joven que el MRCA de los humanos modernos, sigue siendo inverosímil explicar la distribución geográfica conocida de la variación de la secuencia del mtDNA por la migración humana que ocurrió solo en los últimos años.

El cálculo se realiza de la siguiente manera: Consideremos dos seres humanos elegidos al azar. Suponiendo que todos los seres humanos tengan inicialmente ADN mitocondrial idéntico, después de 33 generaciones, dos familias humanas aleatorias probablemente diferirán en dos mutaciones, ya que habrá dos líneas de herencia separadas y probablemente una mutación a lo largo de cada línea. Después de 66 generaciones, dos humanos elegidos al azar diferirán en aproximadamente cuatro mutaciones. Después de 100 generaciones, se diferenciarán en unas seis mutaciones. Después de 300 generaciones, diferirán en aproximadamente 18 mutaciones, que es aproximadamente el valor observado.

Estos experimentos son bastante preocupantes para los evolucionistas que previamente calcularon que la "víspera mitocondrial" (cuyas mitocondrias se cree que son las mitocondrias ancestrales de todos los seres humanos vivos) vivió hace unos 100.000 a 200.000 años en África. 1 Los nuevos cálculos, basados ​​en los experimentos anteriores, la convertirían en una mujer relativamente joven.

6.500 años. Ahora, la noción anterior de que los humanos modernos tienen hasta 10,000 generaciones debe ser reevaluada o al menos la base del ADNmt para esa suposición debe reevaluarse, y lo ha sido. 2

Los estudios más recientes de la tasa de mutación directa del mtDNA también parecen confirmar los hallazgos anteriores de Parsons y otros. En un artículo de 2001 publicado en Revista estadounidense de genética humana, Evelyne Heyer et. Alabama., presentaron sus hallazgos sobre la tasa de mutación del mtDNA en árboles genealógicos franco-canadienses profundamente arraigados.

Sus hallazgos "confirman [ed] hallazgos anteriores de tasas de mutación mucho mayores en las familias que las basadas en comparaciones filogenéticas. . . Para las secuencias de HVI, obtuvimos 220 generaciones o 6.600 años, y para las secuencias de HVII 275 generaciones o 8.250 años. Aunque cada uno de estos valores está asociado con una gran varianza, ambos apuntan a

7.000-8.000 años y, por lo tanto, hasta el Neolítico temprano como la época de expansión [en su mayoría de origen del norte de Europa]. . . Nuestra estimación general de la tasa de mutación de CR de 11,6 por sitio por millón de generaciones. . . es mayor, pero no significativamente diferente, que el valor de 6,3 informado en el reciente estudio genealógico de tamaño comparable. . . En otro estudio (Soodyall et al. 1997), no se detectaron mutaciones en 108 transmisiones. Por otro lado, se observaron dos sustituciones en 81 transmisiones de Howell et al. (1996), y se observaron nueve sustituciones en 327 transmisiones de Parsons et al. (1997). La combinación de todos estos datos (1.729 transmisiones) da como resultado una tasa de mutación de 15,5 (Cl 10,3-22,1). Teniendo en cuenta solo aquellos de pedigrí de raíces profundas (1.321 transmisiones) (Soodyall et al. 1997 Sigurdardottir et al. 2000 el presente estudio) conduce al valor de 7,9. Este último, al evitar problemas experimentales con la heteroplasmia, puede proporcionar una aproximación más realista de la tasa de mutación global ''. 44

Además, considere un artículo de 2003 publicado en el Annals of Human Genetics (Anales de genética humana) por B. Bonne-Tamir et al. donde los autores presentaron los resultados de un estudio de los "linajes maternos y paternos" de una pequeña comunidad samaritana aislada. En este artículo concluyeron:

"En comparación con los resultados obtenidos por otros sobre las tasas de mutación del mtDNA, nuestra estimación del límite superior de la tasa de mutación de 1/61 mutaciones por generación está en estrecha concordancia con los publicados anteriormente". 45 [en comparación con la tasa determinada por Parsons de 1/33 generaciones, una tasa de 1/61 no es más del doble]

Otro artículo interesante publicado en septiembre de 2000 en la Revista Científico por Denver et al. también es bastante interesante. Estos científicos informaron sobre su trabajo con las tasas de mutación del mtDNA de los gusanos nematodos y descubrieron que los relojes moleculares de estos gusanos en realidad funcionan.100 veces más rápido de lo que se pensaba anteriormente& quot [énfasis añadido]. 46

“Extrapolar los resultados directamente a los humanos no es posible, dicen los científicos. Pero sus resultados apoyan estudios controvertidos recientes que sugieren que el reloj molecular humano también funciona 100 veces más rápido de lo que se piensa habitualmente. Esto puede significar que las estimaciones de divergencia entre chimpancés y humanos, y la aparición del hombre moderno, sucedieron mucho más recientemente de lo que se cree actualmente, dice el equipo. "Nuestro trabajo parece respaldar los análisis en humanos, que han sugerido una tasa muy alta", dice Kelley Thomas de la Universidad de Missouri. "Este trabajo es relevante para los seres humanos", dice Doug Turnbill del Instituto de Genética Humana y la Universidad de Newcastle, Reino Unido. "Si la tasa de mutación humana es más rápida de lo que se pensaba, tendría un gran impacto al observar las enfermedades humanas y la ciencia forense, así como la tasa evolutiva de los humanos". . . .

Las tasas de mutación del mtDNA en humanos generalmente se estiman comparando secuencias de ADN de personas y otros animales. "Este es un tipo de análisis que se utilizó para determinar que el origen africano de los humanos modernos fue hace unos 200.000 años", dice Thomas. "El problema con este enfoque es que se está observando tanto la tasa de mutación como los efectos de la selección natural", dice. La técnica también pasaría por alto múltiples mutaciones en el mismo tramo de ADNmt, dice Paul Sharp del Instituto de Genética de la Universidad de Nottingham, Reino Unido.

Estudios más recientes han analizado el ADNmt de personas que son parientes lejanos pero comparten un antepasado femenino. Este enfoque ha revelado mayores tasas de mutación del mtDNA. Pero los resultados no han sido aceptados por muchos científicos. [énfasis añadido].

Conocer la tasa exacta de mutación en humanos es muy importante para la ciencia forense y los estudios de enfermedades genéticas, enfatiza Turnbill. La identificación forense a menudo se basa en comparar muestras de ADN con muestras de familiares sospechosos. Los relojes moleculares humanos más rápidos podrían complicar las relaciones exactas establecidas, dice. "46

Obviamente, entonces, estas tasas, basadas en observaciones más directas, no se acercan a las basadas en supuestos evolutivos indirectos. Esto ciertamente "complica" las cosas un poco ahora, ¿no es así? ¿No es extraño, sin embargo, que muchos científicos todavía se resistan a aceptar estos resultados? El sesgo a favor tanto de la evolución como de millones de años para supuestos tiempos de divergencia entre criaturas como los simios y los humanos es tan fuerte que cambiar las mentes de quienes ocupan esas posiciones puede ser prácticamente imposible.

Hay muchos otros problemas potenciales para las filogenias que se basan en el análisis de la secuencia del mtDNA y las tasas de mutación. Un problema es que el mtDNA funciona como un solo locus genético, de forma muy similar a como lo hace un solo gen en el nucDNA. Los estudios que funcionan con un solo locus genético tienen más probabilidades de verse afectados por cambios genéticos aleatorios que los estudios que incluyen más de un locus (cuanto más, mejor). Por lo tanto, los estudios de un solo locus son menos precisos para caracterizar una población. Más allá de esto, la nueva evidencia de la mezcla de ADNmt paterno es bastante problemática. dieciséis

Además, como se discutió brevemente anteriormente, el uso de regiones de control como un reloj molecular puede no ser tan válido como se esperaba anteriormente. Algunas regiones de nucleótidos mutan lentamente, mientras que otras pueden mutar con relativa rapidez. 17 Estos "puntos calientes" mutacionales pueden mutar con bastante rapidez incluso dentro de una sola vida y son intuitivamente bastante comunes en los ancianos. 18 Por supuesto, tales mutaciones & quot; quotsomáticas & quot; surgen en las mitocondrias de varios tejidos corporales y, a menos que involucren gametos, no se transmiten a la siguiente generación. Sin embargo, aún afectarían las interpretaciones filogenéticas. Los científicos han intentado compensar estos problemas, pero los diversos métodos han producido resultados divergentes. 19 Además, como se discutió anteriormente, las comparaciones directas de secuencias modernas con secuencias históricas a menudo arrojan resultados muy diferentes de los estimados por métodos indirectos que se basan en las diferencias de secuencia actuales. Para otro ejemplo de una especie diferente, las comparaciones directas de pingüinos modernos con pingüinos secuenciados históricamente han demostrado que sus tasas de mutación del mtDNA son de 2 a 7 veces más rápidas de lo que se había asumido previamente a través de métodos indirectos. 20 De hecho, algunos de estos problemas han llevado a algunos científicos a dejar de usar secuencias de regiones de control para reconstruir filogenias humanas. 21

Aquellos científicos que continúan intentando revisar la hipótesis del reloj molecular han intentado ralentizar el reloj mostrando que algunas regiones de ADNmt mutan mucho más lentamente que otras regiones. El problema aquí es que, obviamente, estas regiones se ven afectadas por la selección natural. En otras palabras, no son funcionalmente neutrales con respecto a las presiones de selección.

Por ejemplo, los experimentos en tiempo real han demostrado que las tasas de mutación del genoma mitocondrial promedio son de alrededor de 6 x 10 -8 mut / sitio / generación mitocondrial, en línea con varias estimaciones de tasas de mutación bacteriana promedio (comparar con la tasa de nDNA de 4.4 x 10 -8 mut / sitio / generación humana). Con un tiempo de generación promedio de 45 días, eso es aproximadamente 5 x 10 -6 mut / sitio / año y 5 mut / sitio / myr.

Esto es aproximadamente el doble de la tasa de Parsons de 2.5 / mut / site / myr y alrededor de 40 a 50 veces más alta que las tasas basadas en comparaciones filogenéticas y suposiciones evolutivas. Y esta es la tasa promedio de todo el genoma mitocondrial de 16.000 pb. Uno podría pensar razonablemente que todos los aspectos de las regiones hipervariables (HVI & amp HVII) tendrían una tasa de mutación superior a la media si fueran verdaderamente neutrales con respecto a las presiones de selección funcional. Teniendo esto en cuenta, esos sitios que mutan lentamente con velocidades tan lentas como 0,065 mut / sitio / myr (Heyer et al, 2001) parecerían mantenerse de forma sesgada por la selección natural.

Una vez más, estos cambios no neutrales no son necesariamente el reflejo del tiempo transcurrido desde un antepasado común, sino el reflejo de las diferentes necesidades funcionales de diferentes criaturas en diversos entornos.

Al igual que con las tasas de mutación del ADN mitocondrial, las tasas de mutación del ADN nuclear a menudo se han calculado basándose en escenarios evolutivos más que en métodos directos. Por tales métodos, la tasa de mutación promedio para los eucariotas en general se estimaba, hasta hace relativamente poco tiempo (ver una discusión más detallada a continuación), en aproximadamente 2.2 x 10 -9 mutaciones por par de bases por año. 29 Con un tiempo de generación promedio de 20 años para los seres humanos, esto resulta en alrededor de 4,4 x 10 -8 mutaciones por par de bases por generación. Dado que la mayoría de las estimaciones del tamaño del genoma humano diploide corren alrededor de 6.3 mil millones de pares de bases, esta tasa de mutación le daría al niño promedio alrededor de 277 diferencias mutacionales de sus padres. Esto suena como un número bastante alto y, de hecho, está en el extremo superior del espectro en comparación con los estudios que miran más específicamente las tasas de mutación humana frente a las tasas de mutación eucariota en general. Sin embargo, un estudio original de Nachman y Crowell pareció confirmar esta estimación al comparar las secuencias de control en humanos y chimpancés. Utilizando estas comparaciones de secuencia, se estimó que la tasa de mutación promedio era

2,5 x 10 -8 mutaciones por sitio de nucleótidos o 175 mutaciones por genoma diploide por generación "[Basado en una estimación superior del genoma diploide de 7 mil millones de pares de bases]. 30

Estas estimaciones de la tasa de mutación no directa también parecían razonables dado que parecían coincidir con las tasas de error de replicación del ADN que ocurren entre la formación de un cigoto en una generación y la formación de un cigoto en la siguiente generación. En la ilustración 31 a continuación, observe que desde la fertilización hasta la formación del primer gameto funcional de una mujer, se necesitan aproximadamente 23 divisiones mitóticas. Los hombres, por otro lado, contribuyen aproximadamente al doble de mutaciones de la línea germinal que las mujeres en promedio. 33 Al menos parte de la razón es que las células madre en los hombres se siguen dividiendo, de modo que cuanto mayor es el hombre antes de tener hijos, ocurren más divisiones mitóticas.

Ahora, considere que cada cigoto diploide fertilizado contiene alrededor de 6 mil millones de pares de bases de ADN (

3 mil millones de cada gameto / padre, usando un número de ronda conservador). 32 Desde la división celular hasta la división celular, la tasa de error de la ADN polimerasa combinada con otras enzimas reparadoras es de aproximadamente 1 error en mil millones de pares de bases copiados. 42 A este ritmo, hay alrededor de 6 errores con cada evento de replicación de células diploides. Con un promedio masculino / femenino de 29 divisiones mitóticas antes de la producción de la próxima generación, esto resulta ser alrededor de 175 mutaciones por generación.

Por supuesto, esto está en línea con las tasas de mutación que se basan en escenarios evolutivos. Sin embargo, algunas estimaciones sitúan la tasa de mutación general tan baja como 1 error en 10 mil millones de pares de bases copiados. 43 A este ritmo, uno esperaría alrededor de 0.6 errores con cada evento de replicación y solo alrededor de 17 mutaciones por persona por generación. Entonces, ¿quizás está sucediendo algo más que también influye en la tasa de mutación del ADN nuclear? Resulta que los errores de replicación no son las únicas fuentes de mutaciones del ADN. El daño al ADN puede ocurrir y ocurre a menudo de manera espontánea. La estabilidad del genoma se ve continuamente desafiada por una serie diversa de fuerzas mutagénicas que incluyen errores durante la replicación del ADN, factores ambientales como la radiación UV y mutágenos endógenos como los radicales libres de oxígeno generados durante el metabolismo oxidativo. Este daño también debe detectarse y repararse de forma constante. Por supuesto, esta reparación no es perfecta y, por lo tanto, probablemente contribuya significativamente a la tasa de mutación real por encima de la estimada por los métodos indirectos ya discutidos.

Por otro lado, los métodos más directos para detectar las tasas de mutación nuclear en animales sugieren que la tasa real medida a menudo es bastante diferente a las tasas sugeridas por los supuestos evolutivos (tanto más altos como más bajos). Por ejemplo, la tasa de mutación observada para C. elegans resultó ser diez veces mayor que las estimaciones basadas en métodos indirectos y supuestos evolutivos. Considere el siguiente extracto de Denver et. Alabama. publicado en Naturaleza en 2004:

“Los enfoques alternativos en mamíferos, que se basan en comparaciones filogenéticas de loci de pseudogenes y posiciones de codones degenerados cuádruples, adolecen de incertidumbres en el número real de generaciones que separan las especies comparadas y la incapacidad de excluir los sesgos asociados con la selección natural. Aquí proporcionamos una estimación directa e imparcial de la tasa de mutación nuclear y su espectro molecular con un conjunto de C. elegans líneas de acumulación de mutaciones que revelan una tasa de mutación aproximadamente diez veces mayor que las estimaciones indirectas anteriores y un exceso de inserciones sobre deleciones. & quot (ver enlace)

Recientemente, también ha habido algunas mediciones directas de las tasas de mutación humana que no están del todo en línea con las tasas basadas en supuestos evolutivos. Un artículo publicado en Science intentó una medición directa de la tasa de mutación comparando las secuencias del genoma completo de dos descendientes y sus padres. Estiman que cada descendencia tenía solo 70 mutaciones nuevas para una tasa de mutación de 1,1 x 10 -8 por genoma haploide por generación (Roach et al. 2010: Enlace). Ahora, esta tasa es para un genoma haploide, que sería equivalente a una tasa de

140 mutaciones por genoma diploide (es decir, bastante cerca de la tasa indicada anteriormente para un genoma diploide de

170 mutaciones por generación). Si es cierto, entonces el tiempo de divergencia entre humanos y chimpancés tendría que establecerse en 9 Myr y muchos estudios de la evolución humana reciente podrían tener una diferencia de al menos dos.

¿Así que cuál es el problema? Bueno, dada una tasa de mutación de 140 por persona por generación, y el hecho de que la mayoría de las mutaciones funcionales son dañinas, ¿cómo es que el acervo genético humano no se degenera con el tiempo? Esto podría haber sido reconocido como un enigma significativo si no fuera por el hecho de que hasta aproximadamente 2014 la mayoría de los científicos pensaba que gran parte del genoma humano no tenía un papel funcional significativo. Por lo tanto, se creía que podía soportar un gran número de mutaciones sin ningún efecto perjudicial significativo sobre la función general del organismo. La cantidad de este ADN no funcional se estimó una vez calculando la porción codificante del ADN y restándola del total de bienes raíces genómicas. Dada la porción de codificación promedio de un gen humano en alrededor de 1350 pares de bases de tamaño (que codifica una proteína de aproximadamente 450 aminoácidos de tamaño) 38, todo lo que uno tiene que hacer es multiplicar este número por el número total de genes para llegar a una estimación razonable. de la cantidad total de bienes raíces genéticos codificantes, que originalmente se pensaba que estaba entre el 2 y el 5% del genoma.

Sin embargo, hubo bastante desacuerdo en cuanto al número total de genes en el genoma humano durante bastante tiempo. Durante muchos años se pensó que los humanos tenían entre 70.000 y 140.000 genes. Sin embargo, los científicos que trabajan en el proyecto del genoma humano hicieron un descubrimiento sorprendente. Cuando terminaron un borrador del proyecto en febrero de 2001, estimaron que el recuento de genes real estaba entre 30.000 y 40.000 genes. 39 Pero un año después, en febrero de 2002, en la reunión anual de la Asociación Estadounidense para el Avance de la Ciencia (editor de Ciencias), uno de los presentadores, Victor Velculescu, sugirió que, después de todo, el número real de genes en el genoma humano podría estar más cerca de los 70.000 genes. 40

Por supuesto, la estimación actual del número de genes en el genoma se ha reducido a 20-30.000. Sin embargo, este número es casi irrelevante ahora que se ha descubierto que porciones de ADN que no codifican proteínas, como muchos de los llamados pseudogenes y miro-ARN, tienen una funcionalidad significativa, junto con otras vastas extensiones de ADN no codificante. De hecho, ahora se sugiere que una fracción significativa del genoma humano es funcional con estimaciones que oscilan entre el 16 y el 20% (Kellis, 2014). Algunas estimaciones han ido incluso más altas que eso (ver enlace). Este aumento en la cantidad conocida de espacio funcional dentro del genoma hace que sea mucho más probable que una mutación aleatoria sea realmente relevante desde el punto de vista funcional. Eso podría parecer un problema bastante significativo dada una tasa de mutación de alrededor de 170 mutaciones por persona por generación. Sin embargo, a partir de 2012, las mediciones directas de las tasas de mutación de nucDNA basadas en el análisis de líneas familiares modernas sugieren que la tasa de mutación de nucDNA real es de alrededor de 70 mutaciones puntuales por persona por generación (Peter D. Keightley, 2012), que es menos de la mitad de las estimaciones anteriores. Si bien esto ayuda a alguien con el problema de la tasa de mutación perjudicial, realmente no resuelve el problema dado el aumento mucho más significativo en la cantidad de bienes raíces genéticos conocidos que son realmente funcionales en un grado u otro.

Ancestro común de humanos y simios & quot; Viviendo con los dinosaurios & quot?

Como un aparte interesante, esta tasa reducida de mutación del ADNc altera significativamente el `` reloj '' basado en el ADN en cuanto a cuánto tiempo se supone que los humanos y los simios han compartido un ancestro común, desde hace unos seis millones hasta hace unos 40 millones de años ''. (Callaway, 2012). "Este reloj muy lento tiene el ancestro común de los monos y los humanos coexistiendo con los últimos dinosaurios". Ese es un problema que David Reich (Departamento de Genética, Facultad de Medicina de Harvard) destaca al señalar:

Se pone muy realmente complicado. De hecho, diría que "muy complicado" es una subestimación cuando tienes al ancestro común de los humanos y los simios viviendo con los dinosaurios.

y el deterioro genético de la humanidad

Quienes estudiaron originalmente esta pregunta sugirieron una tasa de mutación perjudicial (Ud) de 1 a 3 por persona por generación, con al menos algunos científicos (Nachmann y Crowell, 2000) favoreciendo al menos 3 o más. 30 Por supuesto, es probable que las tasas reales de mutación perjudicial, como se señaló brevemente anteriormente, sean mucho más altas. En cualquier caso, incluso dadas estas suposiciones iniciales (dado que las mutaciones perjudiciales superan en número a las mutaciones beneficiosas en al menos 1.000 a 1), parecía que la acumulación de mutaciones perjudiciales en una población podría conducir a la extinción. 34,36

Nachmann y Crowell detallan esta desconcertante situación en la siguiente conclusión de su artículo sobre las tasas de mutación humana:

La alta tasa de mutaciones nocivas en humanos presenta una paradoja. Si las mutaciones interactúan multiplicativamente, la carga genética asociada con una U [tasa de mutación perjudicial] tan alta sería intolerable en especies con una tasa baja de reproducción [como humanos y simios, etc.]. . .

La reducción en la aptitud (es decir, la carga genética) debido a mutaciones deletéreas con efectos multiplicativos viene dada por 1 - e -U (Kimura y Moruyama 1966).Para U = 3, la aptitud promedio se reduce a 0.05, o dicho de otra manera, cada hembra necesitaría producir 40 crías para 2 para sobrevivir y mantener la población en un tamaño constante. Esto supone que toda la mortalidad se debe a la selección y, por lo tanto, el número real de descendientes necesarios para mantener un tamaño de población constante es probablemente mayor.

El problema se puede mitigar de alguna manera mediante la selección suave o mediante la selección al principio del desarrollo (por ejemplo, en el útero). Sin embargo, muchas mutaciones son incondicionalmente deletéreas y es improbable que el potencial reproductivo en promedio para las hembras humanas pueda acercarse a los 40 cigotos. Este problema puede superarse si la mayoría de las mutaciones deletéreas presentan epistasis sinérgica, es decir, si cada mutación adicional conduce a una mayor disminución de la aptitud relativa. En el extremo, esto da lugar a una selección de truncamiento en la que todos los individuos que portan más de un número umbral de mutaciones se eliminan de la población. Si bien la selección de truncamiento extremo parece poco realista [la muerte de todos aquellos con un equilibrio mutacional perjudicial], los resultados presentados aquí indican que es probable alguna forma de epistasis positiva entre mutaciones deletéreas. 30

Nachmann y Crowell encontraron esta situación muy desconcertante. ¿Cómo deshacerse de todas las mutaciones malas más rápido de lo que se producen? Propusieron varias posibles soluciones, como un concepto que llamaron & quot; epistasis positiva & quot. Sin embargo, si los efectos funcionales de las mutaciones se incrementaran de forma multiplicativa en lugar de aditiva, ¿resolvería esto el problema? Como se señaló anteriormente, incluso si cada mutación perjudicial causara la muerte de su propietario, la carga reproductiva de los sobrevivientes no disminuiría, pero seguiría siendo la misma.

Por ejemplo, digamos que todos aquellos con al menos tres mutaciones perjudiciales mueren antes de reproducirse. El promedio de la población pronto se situaría por encima de 3 tasas de mutación nociva. Más del 95% de cada generación subsiguiente tendría 3 o más mutaciones deletéreas en comparación con la población "neutral" original. La tasa de mortalidad aumentaría dramáticamente. Para mantenerse al día, las tasas de reproducción de los individuos supervivientes tendrían que aumentar en proporción al aumento de la tasa de mortalidad. Lo mismo sucedería eventualmente si la línea de la muerte se dibujara en 100, 500, 1000, 10000 o más mutaciones deletéreas. La única diferencia sería el tiempo que le tomaría a una población determinada acumular un número letal de mutaciones deletéreas en su acervo genético, comenzando en un punto de partida relativamente "neutral". La población podría sobrevivir bastante bien durante muchas generaciones sin tener que recurrir a grandes aumentos en la tasa de reproducción. Sin embargo, sin deshacerse de la acumulación de mutaciones deletéreas, la población eventualmente se encontraría experimentando un aumento exponencial en su tasa de mortalidad a medida que su población promedio cruzaba la línea de las mutaciones letales.

Dado que la teoría de la epistasis positiva no parece ayudar mucho a la situación, se debe encontrar algún otro proceso para explicar cómo deshacerse preferentemente de las mutaciones perjudiciales de una población. Considere un extracto de un Científico americano artículo publicado en 1999 titulado & quotMutations Galore & quot:

Según la teoría de la genética de poblaciones estándar, la cifra de tres mutaciones dañinas por persona por generación implica que tres personas tendrían que morir prematuramente en cada generación (o no reproducirse) por cada persona que se reprodujera para eliminar las mutaciones nocivas ahora ausentes [ 75% de tasa de mortalidad]. Los seres humanos no se reproducen lo suficientemente rápido como para soportar un número de muertes tan grande. Como preguntó retóricamente James F. Crow de la Universidad de Wisconsin, en un comentario en Naturaleza sobre el análisis de Eyre-Walker y Keightley: "¿Por qué no estamos extintos?"

La respuesta de Crow es que el sexo, que mezcla los genes, permite que las mutaciones perjudiciales se eliminen en grupos. Los nuevos hallazgos apoyan la idea de que el sexo evolucionó porque los individuos que (gracias al sexo) heredaron varias mutaciones malas eliminan el acervo genético de todas a la vez, al no sobrevivir o reproducirse.

Sin embargo, la selección natural se ha debilitado en las poblaciones humanas con el advenimiento de la medicina moderna, señala Crow. Por lo tanto, teoriza que las mutaciones dañinas ahora pueden estar comenzando a acumularse a un ritmo aún mayor, con consecuencias posiblemente preocupantes para la salud. Keightley es escéptico: piensa que muchas mutaciones levemente deletéreas ya se han generalizado en las poblaciones humanas a través de eventos aleatorios en la evolución y que varias adaptaciones, en particular la inteligencia, han compensado con creces. "Dudo que tengamos que pagar una multa como parece pensar Cuervo", comenta. & quot Nos las hemos arreglado perfectamente hasta ahora. & quot 37

Quizás entonces la respuesta podría encontrarse en una combinación de procesos en los que tanto la replicación sexual como la selección natural desempeñan un papel para evitar que una población que se reproduce lentamente se extinga. Por ejemplo, considere el siguiente cuadro que muestra cómo se acumulan las mutaciones deletéreas en una población que se reproduce por medios asexuales: 49

Observe cómo los números de pérdida (P) de la "clase progenitora" más adecuados en cada generación, mientras que los números de aquellos que tienen un mayor número de mutaciones deletéreas se acumulan cada vez más. En este artículo, Rice señala que en las poblaciones asexuales la única forma de superar realmente esta acumulación de mutaciones perjudiciales es aumentar sustancialmente la tasa de reproducción. Pero, ¿qué pasa con las mutaciones beneficiosas? Rice comenta: “Raras mutaciones inversas y compensatorias pueden mover mutaciones deletéreas, a través del autostop genético, contra el flujo de la polarización genética. Pero esta es una influencia menor, análoga a la turbulencia del agua que ocasionalmente transporta un guijarro a una corta distancia río arriba ''. 49 Entonces, ¿cómo podrían las poblaciones que se reproducen sexualmente superar este problema?

Cuando se trata de poblaciones de reproducción sexual, la capacidad de recombinación genética durante la formación de gametos permite concentrar mutaciones buenas y malas. Por ejemplo, digamos que tenemos dos individuos, cada uno con 2 mutaciones perjudiciales. Dada la recombinación sexual entre estos dos individuos, existe una posibilidad decente de que algunos de sus descendientes (1 posibilidad entre 32) no tengan mutaciones perjudiciales heredadas. Pero, ¿qué sucede cuando la tasa de mutaciones perjudiciales adicionales es bastante alta? - digamos 3 por individuo por generación?

Para analizar esto un poco más, considere otro ejemplo de una población en estado estable de 5,000 individuos cada uno, comenzando con 7 mutaciones perjudiciales y una tasa promedio de mutaciones perjudiciales de 3 por individuo por generación. Dada una tasa de reproducción de 4 descendientes por cada una de las 2.500 parejas (10.000 descendientes), en una generación, ¿cuántos descendientes tendrán las mismas o menos mutaciones perjudiciales que la generación parental?


La selección clonal como mecanismo alternativo para la generación de mutaciones múltiples

Nowell (2) introdujo inicialmente la hipótesis de que la progresión tumoral implica oleadas sucesivas de selección clonal. Bajo esta hipótesis, cada mutación seleccionada imparte una ventaja proliferativa, lo que resulta en sucesivos linajes clonales. La aparición de alteraciones cromosómicas secuenciales se ha demostrado en el melanoma maligno (39) y más extensamente en el adenocarcinoma de colon (40). Una preocupación con la idea de mutaciones secuenciales seguidas de una selección estricta es que cada mutación tendría que conferir una gran ventaja selectiva, incluso mutaciones recesivas que ocurren en solo uno de dos alelos. Aunque se ha propuesto un modelo secuencial de acumulación de mutaciones para la génesis del cáncer de colon humano (40), se ha demostrado que solo una pequeña fracción de los tumores (6,6%) contiene las tres mutaciones delineadas con mayor frecuencia (41). Estos resultados implican que múltiples mutaciones además de las que se encuentran comúnmente pueden estar involucradas en la generación de cánceres de colon.

Un fenotipo mutador y la selección de mutaciones en oncogenes específicos y genes supresores de tumores no son conceptos mutuamente excluyentes, de hecho, ahora se acepta ampliamente que las mutaciones podrían ocurrir al azar, y se podrían seleccionar las mutaciones que gobiernan la proliferación clonal. Además, estos procesos pueden ser interdependientes. Rondas secuenciales de selección de mutaciones que mejoran la proliferación en E. coli dan como resultado una población de células que expresan un fenotipo mutante (42). Con cada ronda de selección de diferentes mutaciones ventajosas, existe una selección concurrente de mutaciones en genes que producen las mutaciones en estos genes (es decir, mutantes mutantes). También se ha demostrado un autostop similar de genes mutantes durante rondas secuenciales de selección en levaduras (R. Kolodner, comunicación personal) y podría ser aplicable al crecimiento de tumores donde la selección es para mutantes que exhiben una ventaja de crecimiento en diferentes condiciones. Hanahan y Weinberg (43), en un análisis exhaustivo, identificaron seis alteraciones esenciales en la fisiología celular que guían el crecimiento maligno. Cada uno de estos cambios puede requerir mutaciones que proporcionen una ventaja de crecimiento selectivo y que puedan enriquecerse concomitantemente en alelos mutantes. Por tanto, tanto la selección clonal como la generación de mutantes mutantes pueden ser operativas durante la progresión del tumor, y la vía predominante puede ser diferente en diferentes tumores.


Opciones de acceso

Obtenga acceso completo a la revista durante 1 año

Todos los precios son precios NETOS.
El IVA se agregará más adelante en el proceso de pago.
El cálculo de impuestos se finalizará durante el pago.

Obtenga acceso a artículos por tiempo limitado o completo en ReadCube.

Todos los precios son precios NETOS.


Materiales y métodos

Cepas y medios bacterianos.

La cepa de tipo salvaje PFM2 es un derivado prototrófico de la E. coli Cepa de referencia K12 MG1655 (73, 74). La cepa MutL PFM5 es un derivado de PFM2 con el mutL gen reemplazado por una secuencia de cicatriz en el marco (75). Los detalles de las técnicas genéticas y los medios utilizados se dan en Materiales y métodos SI.

Estimación de las tasas de mutación mediante pruebas de fluctuación.

Las tasas de mutación a Nal R o Rif R se estimaron utilizando pruebas de fluctuación como se describe (76). Se dan más detalles en Materiales y métodos SI.

Procedimiento MA.

Las líneas MA se originaron a partir de colonias individuales aisladas en placas de agar LB cada día. Cada línea se trazó en estrías para colonias individuales en una placa de agar LB, dos líneas por placa, y se incubó a 37 ° C durante 24 h. Para evitar sesgos, la colonia elegida para el paso fue una bien aislada más cercana a una línea trazada en el centro de la placa. Originalmente se iniciaron 100 líneas de la cepa de tipo salvaje y 70 líneas de la cepa MutL, pero se produjeron pérdidas durante el pase (cuando no se obtuvo una sola colonia), la preparación del ADN, la construcción de la biblioteca y debido a ambigüedades de linaje (ver Análisis de mutaciones compartidas debajo). Cada uno de estos pasos representó una reducción de aproximadamente el 20%, lo que dio como resultado el número de líneas que se indica en la Tabla 1. Las pérdidas fueron aleatorias y, por lo tanto, no deberían afectar los resultados. En ningún caso se perdió una línea porque se extinguió. Se dan más detalles en Materiales y métodos SI.

Estimación de Generaciones y Viabilidad Celular en Colonias.

El número de generaciones por paso, estimado a partir del número de células en colonias de un diámetro determinado, generalmente era de 28 generaciones. La fracción de células muertas en colonias resuspendidas determinadas con el kit de viabilidad bacteriana Live / Dead BacLight (Invitrogen, Inc) fue de 0,05 ± 0,01 (media ± SEM). Se dan más detalles en Materiales y métodos SI.

Preparación de ADN genómico.

Se utilizó el kit de purificación PureLink Genomic DNA (Invitrogen Corp.) para purificar el ADN genómico a partir de 0,5 a 1 ml de cultivos de LB durante la noche inoculados a partir de las reservas del congelador. La concentración y pureza del ADN se evaluaron usando un espectrofotómetro NanoDrop ND-1000 (Thermo Fisher Scientific, Inc.).

Secuenciación y control de calidad.

La secuenciación se realizó en el Beijing Genome Institute (BGI) utilizando la plataforma Illumina HiSeq2000. Para cada línea MA, se retuvieron ∼101 (470 Mbp) lecturas de extremos emparejados (2 × 90 pb) después de descartar las lecturas que no cumplían con el control de calidad de BGI. Se descartaron las lecturas con cualquiera de las siguientes características: (I) ≥10% de bases ilegibles (ii) ≥20% de baja calidad (≤Q20) bases (iii) contaminación del adaptador (superposición de ≥15 pb que permite un desajuste de hasta 3 pb) o (iv) pares de lectura duplicados. Después de dicho filtrado, se retuvo una media del 91,1% de las lecturas.

SNP y llamadas de Indel corto.

La secuencia del genoma de referencia fue la secuencia de referencia NCBI NC_000913.2. Para cada muestra, las lecturas de Illumina se alinearon con E. coli K12 (cepa MG1655) con la herramienta de alineación de lectura corta, BWA (ver. 0.5.9) (77). Se llamaron indeles cortos (≤4 pb) basándose en el mapeo de lectura de los procedimientos de llamada de SNP. Se dan más detalles en Materiales y métodos SI.

Confirmación de la mutación mediante secuenciación convencional.

Seleccionamos al azar 19 BPS de las líneas 3K MA de tipo salvaje (∼20% del total) para su confirmación. Debido a que los indeles generalmente son más difíciles de llamar con precisión que los SNP (78), verificamos los 10 pequeños indeles llamados de la línea 3K MA de tipo salvaje. No hubo llamadas falsas en el conjunto de datos de BPS. Un indel que se había llamado como −G en realidad era una eliminación de 24 nt en un elemento de repetición, todas las demás llamadas indel eran correctas. Se dan más detalles en Materiales y métodos SI.

Anotación de mutación.

Se escribieron varios scripts personalizados para anotar variantes candidatas. Las coordenadas de los genes que codifican proteínas se obtuvieron de la página GenBank de la secuencia de referencia NCBI NC_000913.2. Se determinó que los BPS eran sinónimos, no sinónimos o no codificantes según el código genético. Los BPS no sinónimos se designaron como conservadores o no conservadores según la matriz BLOSUM62 (79) un valor ≥0 se consideró conservador.

Análisis de mutaciones compartidas.

Las cepas de tipo salvaje y MutL experimentaron ∼80 y

75 generaciones de crecimiento, respectivamente, a medida que se verificaron sus fenotipos y a medida que se congelaron y se volvieron a cultivar antes del primer cuello de botella para el protocolo MA. Por lo tanto, las líneas MA podrían compartir mutaciones que ocurrieron durante este período. La alineación de secuencia y el análisis de linaje se utilizaron para distinguir las mutaciones que surgieron independientemente de las que compartían un ancestro común. Se dan más detalles en Materiales y métodos SI.

Simulaciones de Monte Carlo.

Se escribió un script personalizado para simular una distribución aleatoria de BPS correspondiente a los espectros mutacionales observados. Para simplificar, el número de mutaciones se fijó en los números observados. Se simularon 1.000 ensayos.


Ver el vídeo: Cuál es la diferencia? (Julio 2022).


Comentarios:

  1. Ovidiu

    Se logra el mayor número de puntos. Creo que esta es una gran idea. Estoy de acuerdo contigo.

  2. Zulkiramar

    No se me acerca en absoluto.

  3. Garnett

    Confirmo. Y lo he enfrentado. Podemos comunicarnos sobre este tema.

  4. Slecg

    En mi opinión aquí, alguien se ha ido en ciclos



Escribe un mensaje