Información

¿El péptido señal siempre se escinde durante la síntesis de proteínas en el RE?

¿El péptido señal siempre se escinde durante la síntesis de proteínas en el RE?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mi supervisor universitario dijo que la secuencia de señales siempre se divide, sin embargo, mi libro de texto es diferente.

Lo que deduzco de mi libro de texto (aunque no está muy claro, así que no estoy seguro) es que:

  • Una proteína que está destinada a ser completamente extracelular (o entrar en un orgánulo unido a la membrana) tendrá solo una secuencia señal que será escindida por la peptidasa señal.
    • Si hay una proteína que debe tener solo un dominio transmembrana, puede:

a) tienen una sola secuencia de señal, sin embargo, esta no estará al comienzo del N terminal que se está traduciendo. Si hay más aminoácidos cargados negativamente antes de la secuencia señal, entonces cuando la secuencia señal se une al complejo translocón, esta 'cola' inicial se enhebrará a medida que se repele del interior de la célula con carga más negativa. Los aminoácidos que siguen la secuencia tendrán una carga más positiva para permanecer en el citosol en lugar de pasar a la luz del RE. Esto determinará la direccionalidad de esta hebra de dominio transmembrana único. // Alternativamente, puede haber una secuencia señal y los aminoácidos antes están cargados más positivamente y después están cargados más negativamente, por lo que se obtiene la situación inversa en la que la hebra ya sintetizada permanece en el citosol y el resto del polipéptido se enhebra como está sintetizado. De cualquier manera, esto implica solo una secuencia de señales.

b) El polipéptido puede tener una secuencia señal y una secuencia de parada de transferencia, con las cargas en los aminoácidos circundantes determinando la dirección, y luego una secuencia de señal o secuencia de parada de transferencia puede ser escindida por la peptidasa señal.

  • Las proteínas multipaso tienen una serie de péptidos señal / transferencia de inicio y transferencia de parada.

Pero si mi libro de texto (¡o más bien lo que entiendo de él!) Es correcto, entonces algunas, pero no todas, las secuencias de señales se cortan. Entonces, ¿cómo sabe la peptidasa señal cuál escindir?

Realmente agradecería que alguien me dijera que responda esto y también me corrija en lo que me he equivocado en mi comprensión.


El sistema de endomembranas

Visión general: El sistema de endomembranas consta del retículo endoplásmico, el aparato de Golgi, lisosomas, endosomas y vesículas secretoras. Estos compartimentos están involucrados en el procesamiento de proteínas para la exportación desde la célula, proteínas destinadas a los lisosomas y proteínas que ingresan a la célula desde la superficie celular. Una vez que las proteínas ingresan al retículo endoplásmico, nunca regresan al compartimiento del citosol, son transportadas por el transporte de vesículas a los otros compartimentos del sistema. Este flujo de vesículas está muy regulado.

Hay tres subdivisiones principales del sistema de endomambrana.

  • la vía secretora
  • la vía lisosomal y la
  • vía endocitótica

Las proteínas que ingresan al secretor o lisosomal se sintetizan en los ribosomas en el citosol y luego se transfieren al teículo endoplásmico.


El código genético

Figura 1. El código genético. Los codones resaltados en rojo son los codones de terminación. El codón resaltado en verde (AUG) especifica el aminoácido metionina (Met), que es siempre el primer codón de una secuencia codificante de proteína y se denomina codón de inicio.

Traducción es el proceso de utilizar el código genético del ARNm para determinar la secuencia de aminoácidos de la proteína. Esto es literalmente una traducción de un idioma a otro, del código de nucleótidos de cuatro letras al código de veinte aminoácidos. No hay una correspondencia uno a uno entre nucleótidos y aminoácidos, sino 3 nucleótidos consecutivos en el ARNm (denominado codones) se traducen en un solo aminoácido. Hay 64 posibles combinaciones de triplete de nucleótidos y, por tanto, 64 posibles codones. La figura 1 es una tabla de codones que ilustra el codigo genetico, los codones y los aminoácidos que especifican. Este código genético es universal, con algunas excepciones en las mitocondrias (que tienen sus propios genomas). Vale la pena señalar tres cosas en la Figura 1. Primero, los tres codones resaltados en rojo (UAA, UAG y UGA) no codifican para aminoácidos, son los codones de parada que señalan la terminación de la traducción. En segundo lugar, el codón AUS (resaltado en verde) se conoce como el codón de inicioporque siempre es el primer codón en una secuencia codificante de proteína. En tercer lugar, el código genético es redundante, lo que significa que algunos aminoácidos están especificados por más de un codón. De hecho, hay 61 codones y solo 20 aminoácidos. Cada codón solo especifica un único aminoácido, pero un único aminoácido puede especificarse mediante múltiples codones. Por ejemplo, el codón GCA siempre se traduce en el aminoácido alanina, sin embargo, la alanina también se puede especificar mediante los codones GCC, GCG y GCU.


Localización de proteínas

Para que los procesos subcelulares se lleven a cabo dentro de compartimentos o regiones celulares definidos, deben existir mecanismos para asegurar que los componentes proteicos requeridos estén presentes en los sitios y en una concentración adecuada. La acumulación de una proteína en un sitio determinado se conoce como localización de proteínas.

SRP (partícula de reconocimiento de señales) interactúa con la secuencia de señales tan pronto como emerge del túnel de salida del polipéptido ribosómico (1-2). En eucariotas, la elongación del péptido se detiene tras la formación del complejo de cadena naciente de SRP / ribosoma, el complejo se dirige a la membrana del RE mediante la interacción con el receptor de SRP (3). La unión de GTP a SRP y al receptor de SRP es un requisito previo para la formación del complejo del receptor de SRP / SRP. Después del posicionamiento complejo (3), el complejo receptor SRP / SRP se disocia del péptido debido a la hidrólisis de GTP. El péptido en crecimiento se transfiere gradualmente a través del canal conductor de proteínas (el translocón) al lumen del RE (4). Habitualmente, las secuencias señal se escinden co-traduccionalmente mediante SPasas (peptidasas señal), y las secuencias señal escindidas resultantes se denominan péptidos señal (4-5).

El reclutamiento de proteínas es esencialmente una forma de reconocimiento de proteínas, que es posible gracias a la presencia de secuencias de aminoácidos específicas dentro de la estructura de la proteína. Por ejemplo, muchas proteínas unidas a la membrana portan péptidos señal que son reconocidos por receptores de señal que los guían al sitio objetivo. La señal de localización nuclear es uno de esos ejemplos. Las proteínas que están destinadas al retículo endoplásmico también llevan un péptido señal.

En otros casos, las proteínas pueden llevar un parche de señal. Por lo general, consta de aproximadamente 30 aminoácidos que no están presentes en una secuencia lineal, pero que están en estrecha proximidad espacial en el espacio tridimensional.

Curiosamente, la organización de una célula y sus diversas regiones desempeñan un papel en la dirección del reclutamiento de proteínas en un sitio determinado. Por ejemplo, en las células epiteliales, que están polarizadas, la composición de proteínas en la membrana apical es muy diferente a la de la membrana basolateral. Esto se logra mediante el reconocimiento de distintas secuencias señal que dirigen proteínas a cada una de estas regiones. Por ejemplo, las proteínas de la membrana apical están muy a menudo ancladas a GPI (glicofosfatidilinositol) mientras que las proteínas basolaterales tienen secuencias distintivas basadas en diLeu (N, N-dimetilleucina) o tirosina [1].

Las proteínas citosólicas que están asociadas con las membranas plasmáticas a menudo se localizan en función de su interacción con los lípidos de la membrana, como los fosfoinosítidos. El fosfatidilinositol 4,5 bisfosfato (PIP2) es el fosfoinosítido más abundante en células de mamíferos. PIP2 está enriquecido en ciertas regiones de la membrana y, debido a su capacidad para interactuar con los dominios PH (homología de pleckstrina) de proteínas, puede reclutar localmente proteínas que posean dichos dominios. El dominio FERM que contiene proteínas, que unen la actina con la membrana, también puede interactuar con PIP2 [2]. Otro fosfoinosítido estrechamente relacionado, el fosfatidilinositol 3,4,5 trifosfato (PIP3) también puede estar enriquecido en ciertas regiones de la membrana plasmática. Se ha demostrado que el enriquecimiento de PIP3 se acumula en las puntas de las neuronas, lo que induce la polarización celular y la formación de axones [3]. También se sospecha que induce la despolimerización local de actina en las células de Dictyostelium e influye en la migración celular [4], aunque otros estudios en neutrófilos han indicado que su función es la polimerización de actina [5].

Además, los dominios citosólicos de las proteínas transmembrana pueden atraer otras proteínas presentes en el citosol que participan en las cascadas de señalización. Por ejemplo, las tirosina quinasas receptoras (RTK) fosforilan ciertos residuos de tirosina en los dominios citosólicos de las proteínas transmembrana tras la unión del ligando a los dominios extracelulares. Las tirosinas fosforiladas atraen proteínas que poseen dominios SH2 (homología src) o PTB (unión a fosfotirosina), que comprenden un complejo de señalización.

La curvatura de las membranas también puede enriquecer proteínas de ciertos tamaños permitidos y propiedades mecánicas. Por ejemplo, las proteínas transmembrana con forma cónica, como el receptor nicotínico de acetilcolina, prefieren regiones curvadas en la membrana, ya que esto relaja la tensión y la forma de la membrana. Se ha observado una clasificación de los componentes de la membrana que prefieren la curvatura en los bordes de las cisternas de Golgi, lo que reduce la tensión mecánica en las regiones cisternas más planas [6] [7]. Las proteínas que contienen el dominio BAR (Bin / Amphiphysin / Rvs) pueden detectar e inducir curvaturas de la membrana y también ayudar a clasificar las proteínas en diferentes regiones de la membrana en función de la curvatura. Las proteínas del dominio BAR están particularmente enriquecidas en regiones de la membrana con alta actividad endocítica [8] [9].

Entrega dirigida de componentes

La localización de proteínas puede resultar del reconocimiento de proteínas solubles o complejos de proteínas que se difunden pasivamente, sin embargo, esto puede no garantizar una concentración suficiente de componentes para mantener un proceso dado. Esto puede impedir su finalización, particularmente cuando se lleva a cabo en regiones con un volumen citoplásmico limitado, como la punta de una filopodia, o cuando los componentes se voltean rápidamente.

Una forma más eficaz de mantener la concentración de componentes proteicos es mediante su entrega dirigida a través de la red citoesquelética.

El citoesqueleto, que está compuesto por filamentos de actina y microtúbulos, abarca toda la célula y conecta la membrana plasmática al núcleo y otros orgánulos. Estos filamentos cumplen muchos propósitos, desde proporcionar soporte estructural a la célula hasta generar las fuerzas necesarias para la translocación celular. También pueden servir como & lsquotracks & rsquo en los que las proteínas motoras pueden trasladarse mientras transportan carga de un lugar a otro de forma análoga a un tren de carga que transporta carga a lo largo de una red de vías férreas.

La entrega de componentes se facilita principalmente mediante motores moleculares impulsados ​​por ATP / GTP como la miosina V o la miosina X, la kinesina o la dineína. Estas proteínas, o sus homólogos, se han observado en una multitud de tipos de células, incluidas las células de levadura, vegetales y animales. Los motores moleculares dineína y quinesina caminan sobre microtúbulos mientras que la miosina camina sobre filamentos de actina. Como era de esperar, estos motores caminan de manera unidireccional, aunque no necesariamente en la misma dirección que los demás.

El transporte basado en microtúbulos se ha estudiado principalmente en células neuronales. Los axones pueden tener varios micrones de longitud (a veces incluso un metro de largo), por lo que es necesario transportar proteínas, lípidos, vesículas sinápticas, mitocondrias y otros componentes a lo largo del axón. Todos los microtúbulos en los axones son unidireccionales, con extremos & lsquominus & rsquo que apuntan hacia el cuerpo celular y extremos & lsquoplus & rsquo que apuntan hacia la sinapsis. Los motores de Kinesin se mueven a lo largo de estas vías para transportar carga desde el cuerpo celular hasta el axón. La interrupción del transporte de carga mediado por la quinesina se correlaciona con varias enfermedades neuromusculares como la atrofia de los músculos espinales y la atrofia de los músculos bulbar y espinal [10] [11]. Dynein, por otro lado, juega un papel importante en el tráfico de carga en dendritas [12].

Gran parte de nuestro conocimiento sobre la administración basada en miosina proviene de estudios en levaduras, aunque los mecanismos parecen conservarse hasta los humanos. En las células de levadura, los motores de miosina V se utilizan para llevar vesículas a los sitios de gemación [13]. El complejo de actomiosina también se ha implicado en la entrega de vesículas secretoras a sitios de crecimiento, exocitosis y segregación de orgánulos durante la división celular [14] [15] [16]. Otras miosinas que han sido implicadas en el transporte de carga incluyen la miosina VI, que es importante para la generación, clasificación y liberación de vesículas endocíticas [17], y la miosina X, que transporta varias proteínas a las puntas de los filopodios a través de su dominio FERM. Un ejemplo de una proteína transportada por la miosina X es la β-integrina.

Aunque funcionalmente similares, existen diferencias importantes entre los mecanismos de transporte basados ​​en microtúbulos y actina. Mientras que el transporte basado en microtúbulos ocurre a largas distancias, la entrega basada en actina ocurre en distancias mucho más cortas de 1-5 & microm [18], revisado en [19]. Además, los microtúbulos juegan un papel importante en la entrega de carga desde el RE al Golgi ya la membrana celular [20] [21]. El transporte basado en actina, por otro lado, está asociado con la entrega de carga y vesículas a la membrana plasmática, con el objetivo de iniciar protuberancias que crecen y se retraen rápidamente. Estas protuberancias detectan y miden las propiedades mecánicas del microambiente, lo que facilita la migración celular.

Vías de comunicación

Con diferentes procesos que se llevan a cabo en compartimentos subcelulares separados, organizados en diferentes regiones de la célula, la comunicación intracelular es primordial. Dicha comunicación, que se describe con más detalle en & lsquocell signaling & rsquo, permite que las células mantengan la concentración de proteínas específicas y dentro de las regiones correctas, según los requisitos de un proceso o estado celular determinado. En última instancia, esto garantiza que los compartimentos individuales funcionen de manera eficiente y permite que un proceso subcelular impulse a otro. En última instancia, esto permite que una célula facilite sus funciones primarias de una manera eficiente y coherente.

Las vías de señalización pueden transportar una señal que se origina desde el exterior de una célula o desde el interior de varios compartimentos y normalmente implica la translocación de iones, solutos, proteínas y mensajeros secundarios.

Todas las células tienen receptores de superficie y otras proteínas para facilitar la detección de señales del entorno extracelular. Estas señales pueden estar en forma de iones, moléculas pequeñas, péptidos, esfuerzo cortante, fuerzas mecánicas, calor, etc. Una vez que la señal es detectada por el receptor de superficie, se transmite al citoplasma generalmente por medio de un cambio conformacional en el receptor. o cambio en su estado de fosforilación en el lado citosólico. Esto, a su vez, desencadena una cascada de señalización descendente, que muy a menudo culmina en el núcleo. La señal generalmente da como resultado un cambio en el perfil de expresión génica de las células, ayudándolas a responder al estímulo.

Los compartimentos subcelulares también pueden poseer mecanismos que les permitan regularse entre sí y funciones rsquos. Por ejemplo, la síntesis de proteínas y la actividad secretora del RE y del Golgi está modulada por la fosforilación de proteínas o lípidos en sus membranas por enzimas citosólicas como la familia de proteínas A y la proteína quinasa D. Los iones de calcio (Ca2 +) son un medio común de tal señal. transducción. Por lo general, la concentración de estos iones en el citosol es bastante baja (

0,1 y microM), pero puede aumentar a 1 y microM al ser inducido por una señal. El RE es el almacén de iones de Ca2 + y cuando se liberan en el citosol se unen a varias proteínas, modulando su actividad. Por ejemplo, un objetivo de Ca2 + es CaM quinasa, que influye directamente en la movilidad y migración celular controlando la actividad de la quinasa de cadena ligera de miosina.


DISCUSIÓN

En un intento por caracterizar los componentes de la vía de tráfico de Stx, se realizó un cribado genético de moléculas implicadas en el tráfico de toxinas intracelulares. Las células se transfectaron con una biblioteca de ADNc de células Vero y luego se seleccionaron para resistencia a Stx. El ADN plasmídico que se presume que codifica un factor que permite la resistencia a la toxina se recuperó de las células resistentes. Se recuperó un clon después de tres rondas de transfección y enriquecimiento y se encontró que contenía un ADNc que codifica los primeros 124 aminoácidos de una proteína no descrita previamente. La caracterización y clonación adicionales del ADNc de longitud completa reveló que este gen codifica una nueva chaperona Hsp40. Una caracterización inicial demostró que esta molécula está localizada en el RE, donde es capaz de interactuar con BiP y otras chaperonas luminales (36). Los homólogos caninos y humanos de esta molécula se han denominado Erdj3, y se ha demostrado que también interactúan con BiP y proteínas de sustrato mal plegadas (1, 28). En analogía con las chaperonas Hsp40 asociadas con ER de levadura, HEDJ probablemente funciona reconociendo proteínas como mal plegadas y recluta moléculas plegadas aberrantemente en Sec61 para la translocación inversa.

La toxina Shiga, como la ricina y la toxina del cólera, no tiene actividad intrínseca de formación de poros, sin embargo, todas estas toxinas deben acceder al citosol (22, 24). Estas toxinas requieren el tráfico en una ruta tortuosa hasta el RE, a diferencia de las toxinas que ingresan al citosol directamente desde la membrana plasmática o desde el compartimento endosómico. Al carecer de la capacidad de atravesar membranas, la toxina Shiga y las toxinas relacionadas aparentemente utilizan la maquinaria del huésped existente para ingresar al citosol. Recientemente se ha propuesto que estas toxinas pueden imitar la estructura de una proteína desplegada y, por lo tanto, utilizar la maquinaria de translocación del hospedador para el transporte desde el RE al citosol (4, 21).

El proceso de retrotranslocación de proteínas a través de la membrana del RE se ha estudiado ampliamente en levaduras. Los mutantes sensibles a la temperatura han revelado funciones centrales para el translocón de membrana integral, Sec61, así como para un Hsp70 conocido como BiP (o Kar2), en la translocación de proteínas del RE al citosol. Además, se ha demostrado que Jem1p y Scj1p, dos miembros de la familia Hsp40, son necesarios para la retrotranslocación de proteínas mal plegadas (16). La identificación de HEDJ en un análisis de detección de resistencia a toxinas y la demostración de que la toxina interactúa con esta chaperona dentro del RE sugiere que HEDJ juega un papel similar en la translocación de proteínas mal plegadas, así como Stx, del RE de mamíferos.

Las chaperonas de Hsp40 están involucradas en casi todos los aspectos de la síntesis y secreción de proteínas. Utilizando el método de cribado genético descrito aquí, aislamos la primera cochaperona Hsp40 localizada en la luz del RE de células humanas. No se ha examinado el requisito de chaperones localizados en ER en la retrotranslocación de toxinas bacterianas, excepto por el reciente descubrimiento de que el transporte de la toxina del cólera requiere su despliegue por un chaperón conocido como proteína disulfuro isomerasa (33). Se desconoce si la toxina Shiga y la ricina interactúan con la PDI. Además, el mecanismo por el cual estas tres toxinas aparentemente se dirigen al poro Sec61 sigue siendo desconocido. Presumiblemente, los eventos aguas arriba incluyen la interacción con acompañantes localizados en ER que reconocen estas toxinas como proteínas del huésped mal plegadas y las dirigen para su retrotranslocación. Recientemente, se ha acumulado evidencia de que tanto el ricino como la toxina del cólera utilizan el poro Sec61 para acceder al citoplasma desde el RE (16, 27, 29, 33). Sobre la base de su tráfico intracelular similar y su incapacidad para cruzar las membranas del huésped, es probable que la toxina Shiga también utilice el translocón Sec61. Nuestros datos sugieren que Stx puede ser reclutado para el aparato Sec61 por HEDJ y otros acompañantes de ER luminales.

No se han determinado las características estructurales de las toxinas que permiten la translocación, ni se ha determinado el papel de los acompañantes localizados en ER en este proceso. Se ha propuesto que los dominios hidrófobos expuestos son una señal importante para la interacción de las chaperonas de Hsp70 con proteínas mal plegadas. Teniendo esto en cuenta, se ha propuesto que un dominio hidrofóbico ubicado cerca del extremo carboxilo de StxA, la toxina del cólera y la ricina se exponen tras la disociación de las subunidades B y es responsable del reconocimiento de la toxina por parte de los acompañantes del hospedador. En apoyo del papel de esta región en la translocación de toxinas, se ha demostrado que las mutaciones en el dominio hidrófobo de StxA dan como resultado una citotoxicidad disminuida (31). Aún no se ha probado si esta región es crucial para la retrotranslocación de cualquier toxina a través de la membrana del RE. La mutagénesis dirigida de la toxina y HEDJ debería permitir la disección molecular de los residuos implicados en su interacción y debería ser facilitada por los ensayos de unión y transporte in vitro descritos aquí. En última instancia, esta información puede permitir el diseño racional de agentes farmacológicos que inhiben la unión de la toxina a HEDJ y el transporte al citoplasma de la célula huésped.


Métodos

Células y anticuerpos

En este estudio se utilizaron líneas celulares RKO (CRL-2577) y HeLa (CCL-2) y fibroblastos pulmonares primarios MRC-5 (CCL-171), obtenidos de la ATCC. Las células RKO y HeLa se mantuvieron en medio DMEM suplementado con FCS al 10% (Sigma-Aldrich, St. Louis, MO) y con 1% de pen-strep, piruvato de sodio, L-glutamina y aminoácidos no esenciales (Biological Industries, Beit Haemek, Israel). Los fibroblastos MRC-5 se mantuvieron en medio EMEM con los mismos suplementos y se utilizaron por debajo del pase 20. Se cultivaron células transducidas con ARNhc en medio de selección que contenía puromicina 5 µg / ml (Merck Millipore, Billerica, MA). Las células transfectadas con EYFP se cultivaron en medio de selección que contenía 2 mg / ml de G418 (Sigma-Aldrich). Se aislaron células NK de linfocitos de sangre periférica utilizando el kit de enriquecimiento de células NK humanas EasySep (StemCells Technologies, Vancouver, Canadá). Las células NK se cultivaron conjuntamente con células alimentadoras alogénicas irradiadas y se activaron usando 500 U / ml de rhIL-2 (PeproTech, Rehovot, Israel) y 20 µg / ml de PHA (Roche, Basilea, Suiza). La pureza de NK se midió & gt95% mediante tinción por citometría de flujo para la fracción CD56 + CD3 -. Todas las células primarias se obtuvieron de acuerdo con las pautas institucionales y los permisos para el uso de tejidos humanos.

El anti-MICA (clon 159227, R & ampD Systems, Minneapolis, MN), anti-MICB (clon 236511, R & ampD Systems), anti-ULBP1 (clon 170818, R & ampD Systems), anti-ULBP2 / 5/6 (clon 165903, R & ampD Systems), anticuerpos primarios anti-ULBP3 (clon 166514, R & ampD Systems) y anti-MHC clase I (hibridoma W6 / 32) se utilizaron para la citometría de flujo. Los anticuerpos primarios anti-PDI (policlonal de conejo, Abcam, Cambridge, MA), anti-MICA (clon 159227, R & ampD Systems) y anti-etiqueta His (clon AD1.1.10, R & ampD systems) se utilizaron para la inmunofluorescencia.

Se usaron los siguientes anticuerpos secundarios para citometría de flujo e inmunofluorescencia: AlexaFluor 647 anti-ratón y Cy3 anti-conejo, todos adquiridos de Jackson Laboratories (Bar Harbor, ME).

Se utilizaron los siguientes anticuerpos primarios para la inmunotransferencia: etiqueta anti-His (clon AD1.1.10, sistemas R & ampD), anti-MICA (clon EPR6568, Abcam), anti-SEL1L (policlonal de conejo al extremo N-terminal, Sigma-Aldrich), EYFP anti-GFP de reacción cruzada (policlonal de conejo, ab290, Abcam), anti-HRD1 (policlonal de conejo, NB100-2526, Novus Biologicals, Centennial, CO), anti-ubiquitina (clon FK2, Merck Millipore), anti-GAPDH (clon 6C5, Santa Cruz, Dallas, TX) y anti-vinculina (clon EPR8185, Abcam).

Se utilizaron los siguientes anticuerpos secundarios para la inmunotransferencia: anti-HRP de ratón y anti-HRP de conejo, específicos de cadena ligera y pesada, o específicos de cadena ligera, todos adquiridos en los laboratorios Jackson.

Mutagénesis por PCR, transfección de plásmidos y transducción lentiviral

Las construcciones US8-HIS y US9-HIS se describieron previamente 28 y se utilizaron como plantillas para la mutagénesis por PCR. En el archivo de información complementaria se incluye una tabla que detalla los cebadores y las plantillas utilizadas para cada reacción. Para las construcciones de EYFP, los fragmentos de PCR se amplificaron y clonaron en pIRES-neo FLAG / HA EYFP (Addgene # 10825 amable obsequio del Dr. K. Le-Trilling, University Hospital Essen, Alemania) usando los sitios de restricción EcoRV y NotI. A continuación, los plásmidos se transfectaron directamente en células usando el reactivo de transfección TransIT-LT1 (Mirus). Todas las demás construcciones se clonaron en el vector lentiviral pHAGE-DsRED (-) - eGFP (+) usando los sitios de restricción NotI y BamHI. Todas las construcciones se validaron mediante secuenciación de ADN. Los lentivirus se generaron en células 293T utilizando un protocolo de transfección transitoria de tres plásmidos 81: los plásmidos que contenían el inserto, Gag-pol y PDMG se transfectaron y los sobrenadantes que contenían la progenie de lentivirus se recolectaron 48 h más tarde, se centrifugaron para eliminar los restos celulares y se almacenaron a -80ºC. ° C. La transducción se realizó en presencia de Polybrene (6 μg / ml). La eficacia de la transducción se evaluó mediante los niveles de fluorescencia, y solo se utilizaron para los experimentos poblaciones de células con una eficacia & gt90%. Se repitió la transducción si era necesario para obtener la eficiencia deseada.

Genotipado MICA

El ADN genómico se extrajo de los fibroblastos MRC-5 utilizando el kit de extracción de ADN genómico AccuPrep (Bioneer, Daejeon, Corea del Sur) de acuerdo con las instrucciones del fabricante. Los exones 2-5 de MICA se amplificaron utilizando cebadores previamente descritos (FW: CGTTCTTGTCCCTTTGCCCGTGTGC y REV: GATGCTGCCCCATTCCCTTCCCAA) 28,82, y los productos de PCR resultantes se ligaron luego en plásmidos pGEM T-easy (Promega, Madison, WI) y se enviaron para secuenciación. Las secuencias se compararon con todos los alelos MICA conocidos en la base de datos IMGT / HLA (http://www.ebi.ac.uk/ipd/imgt/hla/) y se verificaron anotando manualmente los exones y alineándolos con los alelos candidatos utilizando una secuencia global. alineación (emboss.bioinformatics.nl/). Se realizaron al menos cuatro secuencias separadas antes de que una línea celular se considerara homocigótica.

Infección por HCMV

El mutante de deleción US9 (ΔUS9) se generó previamente usando el AD169 clonado con BACvarGenoma L pAD169 28. Las reservas de virus se cultivaron en fibroblastos de prepucio humano, se titularon usando un ensayo de placa y se almacenaron a -80 ° C. La infección se llevó a cabo con una multiplicidad de infección (MOI) de 2,5, en fibroblastos MRC-5 confluentes. La infección por HCMV se incrementó mediante centrifugación a 800 × gramo durante 30 min. Los fibroblastos infectados de forma simulada se trataron solo con medio y se sembraron en placas a una densidad más baja para que fueran subconfluentes en el momento en el que se recogieron las células infectadas. La infección se verificó mediante tinción por citometría de flujo intracelular con anticuerpo anti-CMV (clon 8B1.2, Merck Millipore) a las 24 hpi, y al menos el 85% de las células estaban infectadas.

Derribo SEL1L y HRD1

Se adquirieron cinco clones de ARNhc de SEL1L MISSION de Sigma-Aldrich para cada gen objetivo, se expresaron usando transducción lentiviral como se describe anteriormente, y se cribaron mediante inmunotransferencia para determinar la eficacia de eliminación en células RKO MICA * 008-HA. Se eligieron dos shRNA de SEL1L, designados como # 1 (TRCN0000161385) y # 2 (TRCN0000165954), y dos shRNAs de HRD1, designados como # 3 (TRCN0000364475) y # 4 (TRCN0000364477), para experimentos posteriores.

Inmunofluorescencia

Las células se cultivaron en portaobjetos de vidrio y se fijaron y se permeabilizaron en metanol frío (-20 ° C). Las células se bloquearon durante la noche en bloque CAS (Life Technologies, Carlsbad, CA), luego se incubaron durante la noche con anticuerpos primarios diluidos 1: 200 en bloque CAS, luego se lavaron e incubaron durante la noche en anticuerpos secundarios diluidos 1: 500 en BSA PBS al 5%. Después, las células se lavaron, se trataron durante 5 min con DAPI y se cubrieron con cubreobjetos. Se utilizó un microscopio de barrido láser confocal (Zeiss Axiovert 200M Carl Zeiss MicroImaging, Thornwood, Nueva York) para obtener imágenes. Las imágenes se adquirieron y procesaron utilizando el software Olympus FluoView FV1000.

Citometría de flujo

Para la citometría de flujo, las células se sembraron en placas a densidades iguales y se incubaron durante la noche. Las células resuspendidas se incubaron en hielo durante 1 h con el anticuerpo primario a una concentración de 0,2 µg por pocillo. A continuación, las células se incubaron durante 30 min en hielo con el anticuerpo secundario apropiado a una concentración de 0,75 µg por pocillo. En todos los experimentos que utilizan células transducidas con un lentivirus que expresa GFP o transfectadas con EYFP, los histogramas se activan en la población viva de GFP / EYFP +. La estrategia de activación se describe en la Fig. S2f. Se adquirieron 10.000 células vivas de cada muestra. Se realizaron tinciones de fondo con un anticuerpo secundario solo o con un control de isotipo coincidente en células infectadas con HCMV para todos los tipos de células en el experimento. Se muestra una única tinción de control representativa (identificada en las leyendas de las figuras) para cada experimento, y todas las tinciones de fondo fueron similares a la mostrada. Los datos de citometría de flujo se analizaron utilizando FCS Express versión 6 (De Novo Software, Pasadena, CA).

Ensayo de desgranulación de CD107a

El análisis de CD107a en la superficie de las células NK se describió previamente [51]. Brevemente, las células NK en masa activadas con IL-2 primarias se incubaron conjuntamente con las células diana en una proporción de 1: 1 a 37 ° C durante 2 h, en presencia de un anticuerpo CD107a conjugado con APC y un CD56 conjugado con PE. anticuerpo (Biotest). A continuación, se determinaron los niveles de CD107a en las células NK mediante citometría de flujo. Se utilizaron tres donantes de NK separados para los experimentos. La desgranulación en presencia de objetivos de EV se estableció como 100% y se calculó la reducción normalizada de la desgranulación en comparación con el control de EV para cada mutante.

Inmunotransferencia

Las células se sembraron en placas a una densidad igual, se incubaron durante la noche y se lisaron en tampón que contenía SDS al 0,6% y Tris 10 mM (pH 7,4) suplementado con PMSF 1 mM, aprotinina 1: 100 (Sigma-Aldrich). En ciertos casos, los lisados ​​se digirieron con endoH o PNGaseF (New England Biolabs, Ipswich, MA), de acuerdo con las instrucciones del fabricante. Se realizó electroforesis en gel de poliacrilamida-dodecilsulfato de sodio utilizando geles al 10, 12,5 o 15%. A continuación, las proteínas se transfirieron a membranas de nitrocelulosa. Las membranas se bloquearon durante 1 ha temperatura ambiente (PBS, leche desnatada al 5%, Tween al 0,4%) y se tiñeron usando los anticuerpos primarios y secundarios descritos anteriormente. Las membranas se desarrollaron utilizando el kit EZ-ECL (Biological Industries). Las imágenes se adquirieron y cuantificaron utilizando el software Image Lab (Bio-Rad, Hercules, CA), y el contraste y el brillo de la transferencia se ajustaron según fuera apropiado para una mejor visualización. Las transferencias completas no modificadas se incluyen como un archivo separado.

Fraccionamiento NP40

Las células se sembraron en placas a una densidad igual, se incubaron durante la noche y se lisaron en tampón de lisis NP40 al 1% (NaCl 150 mM, Tris 50 mM, pH 7,4, PMSF 1 mM, aprotinina 1: 100). Los lisados ​​se centrifugaron a 12.000 × gramo durante 10 min y los sobrenadantes se recogieron como la fracción soluble en detergente. Los sedimentos se lavaron tres veces en PBS y luego se resuspendieron en tampón de muestra de proteína, se hirvieron durante 10 min a 99 ° C y se recogieron como la fracción insoluble en detergente.

Persecución de cicloheximida

Para la persecución de cicloheximida, las células se incubaron durante 4-5 h en presencia de cicloheximida (50 μg / ml, Sigma-Aldrich) en combinación con epoxomicina (Merck Millipore) o con un tratamiento simulado con DMSO. Los lisados ​​se prepararon para la inmunotransferencia como se describió anteriormente a las 0 horas y en puntos de tiempo posteriores durante la persecución.

Tratamiento con kifunensina

Las células se sembraron en una placa de 6 pocillos a una densidad de 400.000 células por pocillo. The following day, cells were treated with kifunensine (Cayman Chemical, Ann Arbor, MI) at a concentration of 200 μM or with equivalent concentrations of mock treatment (ultra-pure water). Cells were incubated for 24 h and then harvested for immunoblot analysis as described above.

Inmunoprecipitación

RKO MICA*008-HA cells expressing US9, ΔIg, ΔSer, or ΔN-Ser were plated at equal densities to reach 90% confluence the following day. Cells were then incubated at 37 °C overnight with 50 nM epoxomicin (Merck Millipore). Cells were washed twice in ice-cold PBS and lysed for 30 min on ice in 1% NP40 lysis buffer (150 mM NaCl, 50 mM Tris, pH 7.4) supplemented with mammalian protease inhibitor cocktail (1:100, Sigma-Aldrich). Following lysis, nuclei and debris were cleared by centrifugation (10,000 × gramo, 4 °C, 20 min). Supernatants were pre-cleared for 30 min at 4 °C using an isotype-matched control (mouse IgG1, Biolegend, San Diego, CA) and protein G-plus beads (Santa-Cruz). Beads were then removed by centrifugation (1000 × gramo, 4 °C, 5 min). The pre-cleared supernatants were then mixed with an anti-His tag antibody (AD1.1.10, R&D Systems), and incubated for 1 h at 4 °C on a rotating platform. After 1 h, protein G-plus beads were added for an overnight incubation at 4 °C on a rotating platform. The following day, four washes were performed in ice-cold high-salt 0.2% NP40 wash buffer (500 mM NaCl, 50 mM Tris, pH 7.4) followed by two washes in ice-cold PBS and eluted by boiling for 3 min in twofold concentrated protein sample buffer. The eluates were run in gel electrophoresis on 15% gels which were then stained with Imperial protein stain (Thermo Fisher Scientific, Waltham, MA). Immunoprecipitated bands were excised based on size. For US9, the two isoforms were excised separately. Excised bands were shipped to the Smoler Proteomics Center, Department of Biology, Technion Institute of Technology, analyzed by LC-MS/MS on Q-Exactive (Thermo Fisher Scientific) and identified by Discoverer software against the US9 sequence. All the identified peptides were filtered with high confidence, top rank, mass accuracy, and minimum of two peptides. High confidence peptides have passed the 1% FDR threshold. Semi quantitation was done by calculating the peak area of each peptide. The area of the protein is the average of the three most intense peptides from each protein.

HA-tag immunoprecipitation was performed using anti-HA tag (clone 12B16, Abcam) and protein G-plus beads. RKO MICA*008-HA-US9 cells expressing either shScrambled control or shHRD1#4 were plated overnight as described above and incubated for 5 h with 4 µM of the proteasomal inhibitor EPX. Washing, lysis, preclearance, high-salt washing, and elution were performed as described above.

Co-immunoprecipitation

Cells were plated at equal densities to reach 90% confluence the following day. Cells were then incubated for 4 h at 37 °C with 2 µM epoxomicin, washed twice in ice-cold PBS, and lysed for 30 min on ice in 1% digitonin lysis buffer (150 mM NaCl, 50 mM Tris, pH 7.4) supplemented with mammalian protease inhibitor cocktail (1:100, Sigma-Aldrich). Following lysis, nuclei and debris were cleared by centrifugation (10,000 × gramo, 4 °C, 20 min). Input controls were taken from the supernatants after this stage.

For anti-His tag co-immunoprecipitation, supernatants were pre-cleared for 30 min at 4 °C using an isotype-matched control (mouse IgG1, Biolegend) and protein G-plus beads (Santa-Cruz). Beads were then removed by centrifugation (1000 × gramo, 4 °C, 5 min). The pre-cleared supernatants were then mixed with an anti-His tag antibody (AD1.1.10, R&D Systems), and incubated for 1 h at 4 °C on a rotating platform. After 1 h, protein G-plus beads were added for an overnight incubation at 4 °C on a rotating platform. The following day, four washes were performed in ice-cold 0.2% digitonin wash buffer (150 mM NaCl, 50 mM Tris, pH 7.4) followed by two washes in ice-cold PBS. For immunoblotting, beads were eluted by boiling in twofold concentrated protein sample buffer for 3 min.

For proteomics, the same anti-His immunoprecipitation protocol was used, except that two controls were used: empty-vector-transduced cells immunoprecipitated with an anti-His antibody, and US9-HIS-transduced cells immunoprecipitated with an isotype control. Uneluted beads were stored at −80 °C and shipped to the Smoler Proteomics Center, Department of Biology, Technion Institute of Technology, where LC-MS/MS was performed on Orbitrap XL (Thermo Fisher Scientific), and results were analyzed by the MaxQuant software. All the identified peptides were filtered with 1% FDR threshold and minimum of two peptides. Known contaminants were also excluded.

For anti-HA tag co-immunoprecipitation, covalently attached anti-HA agarose beads (clone HA-7, Sigma-Aldrich) were used according to the manufacturer’s instructions. Elution was performed by boiling in twofold concentrated protein sample buffer for 3 min.

Metabolic labeling

Cells grown in 6-well plates were washed with PBS and metabolically labeled (Easytag Express [35S]-Met/Cys protein labeling, Perkin Elmer, Waltham, MA) with 100 Ci/ml for 20 min. Cells were lysed in digitonin lysis buffer (140 mM NaCl, 20 mM Tris [pH 7.6], 5 mM MgCl2, and 1% digitonin (Merck Millipore)) and cleared from membrane debris at 13,000 rpm for 30 min at 4 °C. Lysates were incubated with anti-His tag antibody for 2 h at 4 °C in an overhead tumbler before immune complexes were retrieved by protein G-sepharose (GE Healthcare, Chicago, IL). Sepharose pellets were washed four times with increasing NaCl concentrations (0.15–0.5 M in lysis buffer containing 0.2% detergent). EndoH (New England Biolabs) treatment was performed as recommended by the manufacturer. Prior to loading onto a SDS-PAGE immune complexes were dissociated at 95 °C for 5 min in a DTT (40 mM) containing sample buffer. Fixed and dried gels were exposed overnight to a phosphor screen, scanned by Typhoon FLA 7000 (GE Healthcare). For better visualization of the results, contrast and brightness were adjusted. A long exposure to X-ray film was used for autoradiography. Images were quantified using the ImageJ software 83 .

Métodos de estadística

A one-way ANOVA was used to compare the effect of the various US9 mutants and chimeras on MICA surface expression (measured as normalized median fluorescent intensity). All mutants sharing the same control groups (e.g., all single US9 mutants, all double US9 mutants, all EYFP chimeras, etc.) were grouped into the same analysis to correct for the relevant multiple comparisons. EV controls were not included in the analyses. Where the ANOVA was statistically significant, a post hoc Dunnett’s test was conducted to determine which mutants differed significantly from the control group. A two-way ANOVA was used to compare the effects of SEL1L knockdown and the various US9 constructs, including EV controls, on MICA surface expression, and where the ANOVA was statistically significant, a post hoc Tukey test was conducted to determine which mutants differed significantly from each other. ANOVAs and post hoc tests were considered statistically significant when pag & lt 0,05. Full statistical details including pag values, F values, degrees of freedom, and effect sizes (Cohen’s D) are presented in the relevant figure legends and/or in the Source data file.

For specific comparison of the effect of US9 on MICA surface and total protein levels in shSCR, shSEL1L, or shHRD1 KD cells, a two-tailed Student’s t-test for unequal variance samples was used, with Sidak’s correction for multiple comparisons. The t-test was considered significant when (p ,<, [1 - (1 - 0.05)^>]) , where metro equals the number of null hypotheses tested. Results from the two shRNA constructs targeting the same gene (SEL1L or HRD1) were pooled together in this analysis.

Where multiple comparisons were not needed, a two-tailed Student’s t-test for unequal variance samples was used without corrections and was considered statistically significant when pag & lt 0,05.

The number of independent experiments analyzed (biological replicates) is indicated in the relevant figure legends. Biological replicates were performed with fresh cells from at least two separate transfections/transductions. The data analysis for this paper was generated using the Real Statistics Resource Pack software (Release 5.4). Copyright (2013–2018) Charles Zaiontz. www.real-statistics.com, and GraphPad Prism version 8 for Windows, GraphPad Software, La Jolla, California, USA, www.graphpad.com.

Resumen de informes

Más información sobre el diseño de la investigación está disponible en el Resumen de informes de investigación de la naturaleza vinculado a este artículo.


RESULTADOS

Optimized biochemical conditions are not sufficient for the efficient cell-free expression of many ORFs

It was previously reported that the efficiency of cell-free protein synthesis is improved remarkably when the reaction mixture is supplied with sufficient amounts of energy and substrates ( 9). For example, in reactions utilizing creatine phosphate for the continuous regeneration of ATP, the use of an excess amount of creatine phosphate enabled prolonged protein synthesis provided that the reaction mixture was supplied periodically with fresh magnesium ions to compensate for their loss through the formation of insoluble magnesium phosphates. Using this approach, as much as 1.2 mg/ml of chloramphenicol acetyltransferase (CAT) could be produced from a single batch reaction of cell-free protein synthesis. An increase in the productivity of many other proteins was also shown after improving the supply of ATP and amino acids ( 9).

However, the provision of optimal biochemical conditions does not always enhance the productivity of cell-free protein synthesis. For example, the expression level of hEPO was not affected significantly in the presence of the elevated levels of ATP and amino acids, and remained at <100 μg/ml. Since all of our ORFs were routinely cloned in the same expression vectors (pK7 and pIVEX2.3d) ( 9, 18), such a discrepancy would be due to the nature of the nucleotide sequences of the structural genes.

Signal peptide sequences-mediated stimulation of protein expression

With respect to the effect of the sequence elements on the efficiency of gene expression, many recent reports strongly suggest that the translational efficiency of a gene is determined primarily by the nature of the initial nucleotide sequences. For example, Stenström and Isaksson recently demonstrated that the translational efficiency of the lacZ reporter gene was critically affected by the identity of the first +2 to +5 codons ( 13). In particular, the expression level was dramatically changed according to which codon was placed at the +2 position. While the expression level of the reporter gene was strongly stimulated when the AAA codon was located at +2 position ( 11), the placement of the NGG codons (CGG, AGG, GGG and UGG) at the same position was associated with remarkably lower expression efficiency ( 12, 20).

Based on their results, it was assumed that the yields of otherwise poorly expressed genes might be stimulated by placing the optimal nucleotide sequences beforehand. It was also expected that such a stimulatory sequence could be used as a universal translation enhancer to increase the productivity of recombinant proteins. In search of the nucleotide sequences that possibly enhance the expression of their fusion partners, the python script was used to analyze the codon usage in the entire E. coli genoma. Interestingly, it was found that the nucleotide sequences of many signal peptides had strong bias for AAA as the second codon. Approximately 40% of signal peptides had the AAA triplet as the second codon ( Table 2).

Codon biases of the nucleotide sequence of the E. coli signal peptides

Sequence data . Frequency of AAA codon at position +2 .
Entero E. coli K12 genome 440/4241 (10.3%)
Unverified E. coli signal sequences 22/45 (48.9%)
Verificado E. coli signal sequences 16/54 (29.6%)
Sequence data . Frequency of AAA codon at position +2 .
Entero E. coli K12 genome 440/4241 (10.3%)
Unverified E. coli signal sequences 22/45 (48.9%)
Verificado E. coli signal sequences 16/54 (29.6%)

E. coli signal sequence data set were obtained from a signal peptide database (http://proline.bic.nus.edu.sg/spdb/). This database currently contains 99 entries of E. coli signal sequences: 54 of the entries are experimentally verified signal sequences (the N-terminal amino acid residues were sequenced), and 45 are computationally predicted sequences ( 17).

Codon biases of the nucleotide sequence of the E. coli signal peptides

Sequence data . Frequency of AAA codon at position +2 .
Entero E. coli K12 genome 440/4241 (10.3%)
Unverified E. coli signal sequences 22/45 (48.9%)
Verificado E. coli signal sequences 16/54 (29.6%)
Sequence data . Frequency of AAA codon at position +2 .
Entero E. coli K12 genome 440/4241 (10.3%)
Unverified E. coli signal sequences 22/45 (48.9%)
Verificado E. coli signal sequences 16/54 (29.6%)

E. coli signal sequence data set were obtained from a signal peptide database (http://proline.bic.nus.edu.sg/spdb/). This database currently contains 99 entries of E. coli signal sequences: 54 of the entries are experimentally verified signal sequences (the N-terminal amino acid residues were sequenced), and 45 are computationally predicted sequences ( 17).

According to the analysis reported by Sato et al. ( 21), >10% of the E. coli genes use AAA as their second codon whereas the frequency of AAA triplet in the entire E. coli genome is 3.3%. It was also suggested that the higher frequency of the AAA triplet at the +2 position is related to the translation efficiency of a gene. Therefore, from the exceptionally high frequency of the AAA triplet as the second codon, it was assumed that the signal sequences might work as a translation-enhancing element.

Therefore, the genes of hEPO with different signal sequences were fused and experiments were carried out to determine if their presence affects the efficiency of protein synthesis in our cell-free synthesis system. The nucleotide sequences of the seven different signal peptides (pelBss, ompAss, phoAss, malEss, ompCss, ompTss, heposs) were fused to the upstream of hEPO sequence in the plasmid pK7hEPO, and the resulting constructs were expressed in the reaction mixture for cell-free protein synthesis. As summarized in Table 3, the five signal sequences except for ompTss and heposs dramatically enhanced the expression level, yielding 9–10 times higher amounts of the target proteins ( Figure 2). For example, the expression level of hEPO was increased from 55 to 588 μg/ml through its fusion with the ompA sequence.

SDS–PAGE analysis of the cell-free synthesized hEPOs fused with different signal peptides. The reaction mixture was incubated at 37°C for 2 h. The reaction mixture (2 μl) was loaded on a 13% Tricine-SDS–PAGE gel and stained with Coomassie Brilliant Blue.

SDS–PAGE analysis of the cell-free synthesized hEPOs fused with different signal peptides. The reaction mixture was incubated at 37°C for 2 h. The reaction mixture (2 μl) was loaded on a 13% Tricine-SDS–PAGE gel and stained with Coomassie Brilliant Blue.

Expression level of the signal peptide-EPO fusion constructs

Plásmido. Signal peptide . Second codon . Expression level a (μg/ml) . Relative level of expression b .
pK7pelBss-EPO pelB AAA 569 ± 34 10.3
pK7ompAss-EPO ompA AAA 588 ± 28 10.7
pK7phoAss-EPO phoA AAA 515 ± 31 9.4
pK7malEss-EPO malE AAA 524 ± 13 9.5
pK7ompCss-EPO ompC AAA 522 ± 24 9.5
pK7ompTss-EPO ompT CGG 107 ± 17 1.9
pK7heposs-EPO heposs GGG 101 ± 13 1.8
Plásmido. Signal peptide . Second codon . Expression level a (μg/ml) . Relative level of expression b .
pK7pelBss-EPO pelB AAA 569 ± 34 10.3
pK7ompAss-EPO ompA AAA 588 ± 28 10.7
pK7phoAss-EPO phoA AAA 515 ± 31 9.4
pK7malEss-EPO malE AAA 524 ± 13 9.5
pK7ompCss-EPO ompC AAA 522 ± 24 9.5
pK7ompTss-EPO ompT CGG 107 ± 17 1.9
pK7heposs-EPO heposs GGG 101 ± 13 1.8

a Data from three independent experiments.

b Expression level as compared with the expression of the wild-type EPO (EPO expression level = 1 EPO expression level = 55 μg/ml)

Expression level of the signal peptide-EPO fusion constructs

Plásmido. Signal peptide . Second codon . Expression level a (μg/ml) . Relative level of expression b .
pK7pelBss-EPO pelB AAA 569 ± 34 10.3
pK7ompAss-EPO ompA AAA 588 ± 28 10.7
pK7phoAss-EPO phoA AAA 515 ± 31 9.4
pK7malEss-EPO malE AAA 524 ± 13 9.5
pK7ompCss-EPO ompC AAA 522 ± 24 9.5
pK7ompTss-EPO ompT CGG 107 ± 17 1.9
pK7heposs-EPO heposs GGG 101 ± 13 1.8
Plásmido. Signal peptide . Second codon . Expression level a (μg/ml) . Relative level of expression b .
pK7pelBss-EPO pelB AAA 569 ± 34 10.3
pK7ompAss-EPO ompA AAA 588 ± 28 10.7
pK7phoAss-EPO phoA AAA 515 ± 31 9.4
pK7malEss-EPO malE AAA 524 ± 13 9.5
pK7ompCss-EPO ompC AAA 522 ± 24 9.5
pK7ompTss-EPO ompT CGG 107 ± 17 1.9
pK7heposs-EPO heposs GGG 101 ± 13 1.8

a Data from three independent experiments.

b Expression level as compared with the expression of the wild-type EPO (EPO expression level = 1 EPO expression level = 55 μg/ml)

Effect of the identity of the second codon on the translation efficiency

However, not all the signal sequences were effective in enhancing the expression of the downstream ORF. For example, the nucleotide sequence of the OmpT signal sequence (ompTss) failed to stimulate the synthesis of hEPO with the amount of the accumulated protein being similar to the wild-type sequence. Similarly, the addition of the natural signal sequence of hEPO (heposs) did not affect the expression level of hEPO.

Interestingly, when the second codons of ompTss and heposs were switched to AAA (from CGG and GGG, respectively), there was an ∼4-fold increase in protein synthesis ( Figure 3A). In contrast, switching the second codons of ompAss and ompCss from AAA to NGG (AGG, TGG, GGG and CGG) almost completely abolished its stimulatory effect ( Figure 3B). This suggests that the identity of the second codon critically affects the stimulatory effect of the signal sequences.

Effect of the expression level of the fused proteins according to the identity of the second codon. The efficiency of cell-free protein synthesis was enhanced by switching the second codon of ompTss and heposs into AAA (A). In contrast, protein synthesis was repressed when the second codons (AAA) of ompAss and ompCss were mutated into NGG codons (AGG, TGG, GGG and CGG) (B). After 2 h incubation, 15 μl of the reaction samples were withdrawn from the reaction mixture, and the [ 14 C]leucine-labeled radioactivity was measured as described in Materials and Methods.

Effect of the expression level of the fused proteins according to the identity of the second codon. The efficiency of cell-free protein synthesis was enhanced by switching the second codon of ompTss and heposs into AAA (A). In contrast, protein synthesis was repressed when the second codons (AAA) of ompAss and ompCss were mutated into NGG codons (AGG, TGG, GGG and CGG) (B). After 2 h incubation, 15 μl of the reaction samples were withdrawn from the reaction mixture, and the [ 14 C]leucine-labeled radioactivity was measured as described in Materials and Methods.

PCR-based addition of the stimulatory signal sequence and the direct expression of the amplified DNAs

Encouraged by the dramatic increase in hEPO expression in the presence of the signal sequences, this study examined whether or not the signal sequence-assisted stimulation of protein synthesis is generally applicable to the expression of other proteins. Sixteen different ORFs that normally show a very low expression level in our cell-free protein synthesis system were selected. Instead of cloning each of the fusion constructs in the expression vector, the PCR-amplified DNA with or without the ompAss were used directly as the templates for cell-free protein synthesis, thereby eliminating the time- and labor-intensive cloning steps ( Figure 4). As summarized in Table 4, the presence of ompAss remarkably enhanced the expression of the target proteins in all the cases examined, which suggests that the proposed strategy can be employed as a general method for boosting the expression of the recombinant proteins in a cell-free protein synthesis system. However, the extent of stimulation showed significant variations among different proteins implying that the expression of protein can also be substantially affected by the nucleotide sequences of the target ORFs.

Construction and expression of the linear expression templates by PCR. (A) Schematic diagram of the PCR-based generation of the ompA fusion constructs. Three primary PCR products with defined overlapping ends were synthesized by the first PCR. These three fragments were joined in the second PCR, overlap extension PCR, which also simultaneously introduced the regulatory elements and the OmpA signal peptide sequence to the target genes. The red bar indicates the overlapping region. The blue and black bar indicate UTR and ORF, respectively. (B) Agarose gel electrophoresis of the PCR products. Second PCR products have an additional 600 bp as a result of the fusion with 5′-UTR and 3′-UTR. (C) Cell-free expression of ompA-fused PCR products. The reaction mixture for cell-free protein synthesis was prepared as described in Materials and Methods. After 2 h of incubation, 2 μl of the reaction mixture was loaded on a 13% Tricine-SDS–PAGE gel and stained with Coomassie Brilliant Blue. Cell-free expressed proteins are indicated by arrows.

Construction and expression of the linear expression templates by PCR. (A) Schematic diagram of the PCR-based generation of the ompA fusion constructs. Three primary PCR products with defined overlapping ends were synthesized by the first PCR. These three fragments were joined in the second PCR, overlap extension PCR, which also simultaneously introduced the regulatory elements and the OmpA signal peptide sequence to the target genes. The red bar indicates the overlapping region. The blue and black bar indicate UTR and ORF, respectively. (B) Agarose gel electrophoresis of the PCR products. Second PCR products have an additional 600 bp as a result of the fusion with 5′-UTR and 3′-UTR. (C) Cell-free expression of ompA-fused PCR products. The reaction mixture for cell-free protein synthesis was prepared as described in Materials and Methods. After 2 h of incubation, 2 μl of the reaction mixture was loaded on a 13% Tricine-SDS–PAGE gel and stained with Coomassie Brilliant Blue. Cell-free expressed proteins are indicated by arrows.

Cell-free expression of the ompAss fused genes

Protein . Wild-type (μg/ml) . ompA fusion (μg/ml) . Relative level of expression a . GenBank ID/references . Molecular weight of protein (kDa) . Origin .
IL-2 91 545 6.0 S77834 15.5 Homo sapiens
TNF-a 226 513 2.3 X01394 17.5 Homo sapiens
DsRed2 b 98 665 6.8 25.9 Synthetic gene
BMP2 128 431 3.4 M22489 13.0 Homo sapiens
Reino Unido 83 387 4.7 NM_008873 30.5 Mus musculus
VEGF Dakota del Norte. 489 X62568 22.3 Homo sapiens
IFN-γ 45 460 10.2 K00083 16.0 Mus musculus
ϖ-TACc 125 487 3.9 AAK25105 47.8 Caulobacter crescentus
ϖ-TAMl 206 537 2.6 BAB48961 48.2 Mesorhozobium loti
ϖ-TATr 173 436 2.5 AAL44116 49.0 Agrobacterium tumefaciens
ϖ-TAVf 237 539 2.3 ( 32) 50.3 Vibrio fluvialis
ϖ-TAXc 198 529 2.7 AAM41635 48.4 Xanthomonas axonopodis
smTG 11 358 32.5 AAS68222 45.7 Streptomyces mobaraensis
oleV 35 645 18.4 AAD55451 53.1 Streptomyces antibioticus
oleW 26 689 26.5 AAD55450 35.8 Streptomyces antibioticus
urdR Dakota del Norte. 702 AAF72551 26.8 Streptomyces fradiae
Protein . Wild-type (μg/ml) . ompA fusion (μg/ml) . Relative level of expression a . GenBank ID/references . Molecular weight of protein (kDa) . Origin .
IL-2 91 545 6.0 S77834 15.5 Homo sapiens
TNF-a 226 513 2.3 X01394 17.5 Homo sapiens
DsRed2 b 98 665 6.8 25.9 Synthetic gene
BMP2 128 431 3.4 M22489 13.0 Homo sapiens
Reino Unido 83 387 4.7 NM_008873 30.5 Mus musculus
VEGF Dakota del Norte. 489 X62568 22.3 Homo sapiens
IFN-γ 45 460 10.2 K00083 16.0 Mus musculus
ϖ-TACc 125 487 3.9 AAK25105 47.8 Caulobacter crescentus
ϖ-TAMl 206 537 2.6 BAB48961 48.2 Mesorhozobium loti
ϖ-TATr 173 436 2.5 AAL44116 49.0 Agrobacterium tumefaciens
ϖ-TAVf 237 539 2.3 ( 32) 50.3 Vibrio fluvialis
ϖ-TAXc 198 529 2.7 AAM41635 48.4 Xanthomonas axonopodis
smTG 11 358 32.5 AAS68222 45.7 Streptomyces mobaraensis
oleV 35 645 18.4 AAD55451 53.1 Streptomyces antibioticus
oleW 26 689 26.5 AAD55450 35.8 Streptomyces antibioticus
urdR Dakota del Norte. 702 AAF72551 26.8 Streptomyces fradiae

a The relative expression level was determined by dividing the amount of the ompA fused protein by the expressed wild-type protein.

b Plasmid pDsRed2 is obtained from Clontech.

Cell-free expression of the ompAss fused genes

Protein . Wild-type (μg/ml) . ompA fusion (μg/ml) . Relative level of expression a . GenBank ID/references . Molecular weight of protein (kDa) . Origin .
IL-2 91 545 6.0 S77834 15.5 Homo sapiens
TNF-a 226 513 2.3 X01394 17.5 Homo sapiens
DsRed2 b 98 665 6.8 25.9 Synthetic gene
BMP2 128 431 3.4 M22489 13.0 Homo sapiens
Reino Unido 83 387 4.7 NM_008873 30.5 Mus musculus
VEGF Dakota del Norte. 489 X62568 22.3 Homo sapiens
IFN-γ 45 460 10.2 K00083 16.0 Mus musculus
ϖ-TACc 125 487 3.9 AAK25105 47.8 Caulobacter crescentus
ϖ-TAMl 206 537 2.6 BAB48961 48.2 Mesorhozobium loti
ϖ-TATr 173 436 2.5 AAL44116 49.0 Agrobacterium tumefaciens
ϖ-TAVf 237 539 2.3 ( 32) 50.3 Vibrio fluvialis
ϖ-TAXc 198 529 2.7 AAM41635 48.4 Xanthomonas axonopodis
smTG 11 358 32.5 AAS68222 45.7 Streptomyces mobaraensis
oleV 35 645 18.4 AAD55451 53.1 Streptomyces antibioticus
oleW 26 689 26.5 AAD55450 35.8 Streptomyces antibioticus
urdR Dakota del Norte. 702 AAF72551 26.8 Streptomyces fradiae
Protein . Wild-type (μg/ml) . ompA fusion (μg/ml) . Relative level of expression a . GenBank ID/references . Molecular weight of protein (kDa) . Origin .
IL-2 91 545 6.0 S77834 15.5 Homo sapiens
TNF-a 226 513 2.3 X01394 17.5 Homo sapiens
DsRed2 b 98 665 6.8 25.9 Synthetic gene
BMP2 128 431 3.4 M22489 13.0 Homo sapiens
Reino Unido 83 387 4.7 NM_008873 30.5 Mus musculus
VEGF Dakota del Norte. 489 X62568 22.3 Homo sapiens
IFN-γ 45 460 10.2 K00083 16.0 Mus musculus
ϖ-TACc 125 487 3.9 AAK25105 47.8 Caulobacter crescentus
ϖ-TAMl 206 537 2.6 BAB48961 48.2 Mesorhozobium loti
ϖ-TATr 173 436 2.5 AAL44116 49.0 Agrobacterium tumefaciens
ϖ-TAVf 237 539 2.3 ( 32) 50.3 Vibrio fluvialis
ϖ-TAXc 198 529 2.7 AAM41635 48.4 Xanthomonas axonopodis
smTG 11 358 32.5 AAS68222 45.7 Streptomyces mobaraensis
oleV 35 645 18.4 AAD55451 53.1 Streptomyces antibioticus
oleW 26 689 26.5 AAD55450 35.8 Streptomyces antibioticus
urdR Dakota del Norte. 702 AAF72551 26.8 Streptomyces fradiae

a The relative expression level was determined by dividing the amount of the ompA fused protein by the expressed wild-type protein.

b Plasmid pDsRed2 is obtained from Clontech.

En el lugar cleavage of signal peptide in an E. coli cell-free protein synthesis system

Although it was shown that the presence of ompAss dramatically enhances the expression of the recombinant proteins, it also adds 21 non-native amino acid residues to the target proteins that might interfere with the biological functions and proper folding of the expressed proteins. Therefore, it would be desirable if the signal peptides are removed during protein synthesis so that the resulting polypeptide of the target protein follows its natural folding pathway. Since the reactions of cell-free protein synthesis are carried out in a crude lysate of E. coli (S30 extract), it was presumed that most of the soluble E. coli proteins are present in the reaction mixture. In addition, the signal peptidase of E. coli retains its activity even when it is detached from the cellular membrane ( 22, 23). Therefore, the added signal peptide should be removed en el lugar by the endogenous signal peptidase activity. As shown in Figure 5A, SDS–PAGE and western blot analyses confirmed that a significant proportion of the cell-free expressed protein had the native size without the signal peptide. This indicates that the S30 extract retains the signal peptidase activity under the reaction conditions for cell-free protein synthesis.

En el lugar cleavage of the signal peptides during cell-free protein synthesis. (A) The indicated concentration of Triton X-100 was added to the reaction mixture from the start of the synthesis reaction, and examined to determine it could increase the level of signal peptide cleavage. After incubation, the reaction mixture was centrifuged at 10 000 gramo for 10 min, and the soluble and pellet fractions were analyzed by 13% Tricine-SDS–PAGE stained with Coomassie Brilliant Blue (upper panel) and western blot using the anti-EPO antibody (lower panel). P and S represent the insoluble and soluble fractions of the cell-free synthesized EPO, respectively. (B) [ 14 C]leucine-labeled radioactivity of the expressed protein was measured as described under Materials and Methods.

En el lugar cleavage of the signal peptides during cell-free protein synthesis. (A) The indicated concentration of Triton X-100 was added to the reaction mixture from the start of the synthesis reaction, and examined to determine it could increase the level of signal peptide cleavage. After incubation, the reaction mixture was centrifuged at 10 000 gramo for 10 min, and the soluble and pellet fractions were analyzed by 13% Tricine-SDS–PAGE stained with Coomassie Brilliant Blue (upper panel) and western blot using the anti-EPO antibody (lower panel). P and S represent the insoluble and soluble fractions of the cell-free synthesized EPO, respectively. (B) [ 14 C]leucine-labeled radioactivity of the expressed protein was measured as described under Materials and Methods.

Tschantz et al. reported that the catalytic activity of truncated E. coli signal peptidase, which lacks the membrane-anchoring domain, was stimulated in the presence of the detergent Triton X-100 ( 22, 24). By taking advantage of the ‘open’ nature of cell-free protein synthesis, an attempt was made to express the ompAss-hEPO construct in the presence of Triton X-100 with the anticipation that the enhanced signal peptidase activity would increase the fraction of the correctly sized product. Indeed, the efficiency of the cleavage of signal peptide was improved remarkably upon the addition of Triton X-100, and virtually all the products were found at the correct molecular weight ( Figure 5A). When tested at different concentrations, the presence of Triton X-100 >0.1% (w/v) effectively facilitated the removal of the OmpA sequence, and virtually all of the cell-free expressed products were found at the native size of EPO. At least up to the concentration of 0.5% (w/v), the presence of Triton X-100 did not affect the efficiency of protein synthesis ( Figure 5B). Therefore, enhanced efficiency of the cleavage of the signal sequence was not due to a reduced yield of protein synthesis. In addition, solubility of the cell-free expressed products was substantially enhanced in the presence of Triton X-100. While the EPO molecules (regardless of the presence of signal sequences) were almost completely insoluble in the reaction mixture without any detergents, ∼70% of the expressed protein was found in the soluble fraction.


The function of SRP was discovered by the study of processed and unprocessed secretory proteins, particularly immunoglobulin light chains [2] and bovine preprolactin. Newly synthesized proteins in eukaryotes carry N-terminal hydrophobic signal sequences, which are bound by SRP when they emerge from the ribosome. [3] [4]

In eukaryotes, SRP binds to the signal sequence of a newly synthesized peptide as it emerges from the ribosome. [1] This binding leads to the slowing of protein synthesis known as "elongation arrest", a conserved function of SRP that facilitates the coupling of the protein translation and the protein translocation processes. [5] SRP then targets this entire complex (the ribosome-nascent chain complex) to the protein-conducting channel, also known as the translocon, in the endoplasmic reticulum (ER) membrane. This occurs via the interaction and docking of SRP with its cognate SRP receptor [6] that is located in close proximity to the translocon.

In eukaryotes there are three domains between SRP and its receptor that function in guanosine triphosphate (GTP) binding and hydrolysis. These are located in two related subunits in the SRP receptor (SRα and SRβ) [7] and the SRP protein SRP54 (known as Ffh in bacteria). [8] The coordinated binding of GTP by SRP and the SRP receptor has been shown to be a prerequisite for the successful targeting of SRP to the SRP receptor. [9] [10]

Upon docking, the nascent peptide chain is inserted into the translocon channel where it enters into the ER. Protein synthesis resumes as SRP is released from the ribosome. [11] [12] The SRP-SRP receptor complex dissociates via GTP hydrolysis and the cycle of SRP-mediated protein translocation continues. [13]

Once inside the ER, the signal sequence is cleaved from the core protein by signal peptidase. Signal sequences are therefore not a part of mature proteins.

Despite SRP function being analogous in all organisms, its composition varies greatly. The SRP54-SRP RNA core with GTPase activity is shared in all cellular life, but some subunit polypeptides are specific to eukaryotes.


Conclusiones y perspectivas

The proprotein convertase furin has become an attractive target for the treatment of various infectious and noninfectious diseases as it regulates the activity of numerous mammalian, bacterial and viral proteins. In recent years, several peptidic and nonpeptidic inhibitors have been developed that block the activation of bacterial toxins, prevent the maturation of viral proteins and suppress tumor growth in vitro. Although some of them also yielded promising results in mouse models, there have been only a limited number of clinical trials in humans.

One major challenge is the redundancy of furin with related proprotein convertases that also recognise polybasic cleavage sites. On the one hand, selective inhibition of furin may be beneficial as it limits unwanted side effects due to inhibition of other PCSKs. On the other hand, treatment of some diseases may require the simultaneous inhibition of several PCSKs to efficiently block pathological substrate conversion. To advance current approaches, a better understanding of the relative contribution of individual PCSKs to (nonphysiological) proteolytic protein processing is urgently needed. Therapeutic intervention needs to specifically target the convertase(s) that drive disease progression. Currently, the most promising approaches for selective inhibition are shRNA-mediated silencing and nanobodies as they show no or only little off-target effects.

Even if selective inhibition of individual PCSKs can be achieved, systemic long-term inhibition will most likely have detrimental effects, as PCSKs are required for the activation of hundreds of cellular substrates. Thus, local applications such as targeted treatment of tumors or topical treatment of bacterial and viral infections may be more feasible than systemic therapy. Finally, the ability of tumor cells or pathogens to evolve resistance or evasion mutations remains poorly investigated. For example, several substrates such as dengue virus prM harbour suboptimal furin target sequences and may optimise their cleavage sites upon therapy to enable sufficient cleavage in the presence of inhibitors.

Although the therapeutic application of furin inhibitors may be full of pitfalls, it is certainly a promising approach that should be further pursued. Future studies will elucidate the role of individual PCSKs and their substrates in disease progression and a better understanding of cellular pathways regulating furin activity may uncover additional targets for therapeutic intervention.


Ver el vídeo: 12 06 Translocación de proteínas (Febrero 2023).