Información

Relación entre nuestro microbioma y la nutrición personalizada

Relación entre nuestro microbioma y la nutrición personalizada


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Recientemente, se ha preguntado si existen 'tipos metabólicos' entre humanos que pueden beneficiarse de una especie de nutrición personalizada. Una respuesta sugirió que un factor de discernimiento podría ser el microbioma humano. Se sabe que los estados simbióticos huésped-microbiano pueden responder de manera diferente a la dieta y la ingesta de medicamentos, pero no tengo claro si esto puede ser útil para una nutrición personalizada. Me pregunto:

¿Afecta el microbioma al metabolismo de los alimentos? (útil para una nutrición personalizada)

O

¿Afectan los alimentos que ingerimos al microbioma? (menos útil para la nutrición personalizada)

Sé que la respuesta es probablemente ambas, pero ¿hay ejemplos que demuestran causalmente una rama y excluyen la otra?


¿Afecta el microbioma al metabolismo de los alimentos?

Definitivamente (y no es sorprendente). El artículo de Arumugam [1] señala que

Los conductores de [enterotipo 1] parecen derivar energía principalmente de carbohidratos y proteínas por fermentación,… Porque los genes que codifican las enzimas implicadas en la degradación de estos sustratos (galactosidasas, hexosaminidasas, proteasas) junto con la glucólisis y las vías de las pentosas fosfato se enriquecen en este enterotipo […]

Enterotipo 2... se enriquece en Prevotella ... y el Desulfovibrio concurrente, que puede actuar en sinergia para degradan las glicoproteínas de mucina presentes en la capa mucosa del intestino [… ]

Enterotipo 3 es [… ] enriquecido en transportadores de membrana, principalmente de azúcares, lo que indica la unión eficaz de la mucina y su posterior hidrólisis, así como la absorción de los azúcares simples resultantes por estos géneros. […]

Los géneros enriquecidos indican que Los enterotipos utilizan diferentes rutas para generar energía a partir de sustratos fermentables disponibles en el colon., que recuerda una potencial especialización en nichos ecológicos o gremios. Además de la conversión de carbohidratos complejos en sustratos absorbibles, la microbiota intestinal también es beneficiosa para el huésped humano al producir vitaminas. Aunque todas las vías del metabolismo de las vitaminas están representadas en todas las muestras, Los enterotipos 1 y 2 se enriquecieron en la biosíntesis de diferentes vitaminas. [… ]

[Todo el énfasis es mío.]

¿Afectan los alimentos que ingerimos al microbioma?

Sí, con la misma certeza. No tengo una publicación a la mano, pero debería ser obvio que nuestra comida influye en nuestro microbioma intestinal; en el caso extremo, puede matarlo (considere los efectos secundarios de los antibióticos).

[1] Manimozhiyan Arumuga, Jeroen Raes & al., Enterotipos del microbioma intestinal humano, Naturaleza 473, 174-180, mayo de 2011.


Sí, el microbioma afecta el metabolismo de los alimentos y la dieta afecta la composición del microbioma. +1 a Konrad por su respuesta. Ésta es un área de investigación en la que estamos involucrados mis colegas y yo. Francamente, es más fácil evaluar los cambios en el microbioma basándose en la dieta en lugar de mirar el material fecal para determinar la energía metabólica (no utilizada) o el potencial dado una cierta entrada (es decir, de una dieta controlada).

Recientemente, hemos alimentado a los humanos con una gran cantidad de porciones de cereales integrales. La respuesta es muy individualista con algunos descensos y otros aumentos en Firmicutes, por ejemplo. Por lo general, los números de Bacteroidetes se mueven en sentido opuesto a Firmicutes, pero no en todos los individuos. Estas observaciones también son vistas por otros en este creciente campo de investigación.

El artículo sobre "enterotipos" que cita Konrad está comenzando a ver cierta resistencia en el campo en el sentido de que los tres enterotipos definidos por esos autores no están realmente tan claramente definidos cuando se mira más de cerca a más individuos. El tiempo dirá qué tan bien se mantiene una vista u otra.


Nutrition for Precision Health, impulsado por el programa de investigación All of Us

El objetivo de la Nutrición para la salud de precisión del Fondo Común de los NIH, impulsado por Todos nosotros Programa de investigación, consiste en desarrollar algoritmos que predigan las respuestas individuales a los patrones alimentarios y dietéticos. La nutrición juega un papel integral en el desarrollo humano y en la prevención y el tratamiento de enfermedades. Sin embargo, no existe una dieta perfecta y única para todos. El programa de NPH se basará en los avances recientes en la ciencia biomédica, incluida la inteligencia artificial (IA), la investigación del microbioma, así como la infraestructura y el gran y diverso grupo de participantes del Todos nosotros Programa de investigación. Estos avances brindan oportunidades sin precedentes para generar nuevos datos que brinden información sobre la nutrición personalizada, también conocida como nutrición de precisión.
Además, el primer Plan Estratégico para la Investigación en Nutrición de los NIH enfatizó las oportunidades para mejorar nuestra comprensión de cómo la biología humana individual y las vías moleculares influyen en las relaciones entre la dieta y los factores ambientales, sociales y de comportamiento para influir en la salud. Diseñado para implementar aspectos del Plan Estratégico, el programa Nutrición para la Salud de Precisión realizará un estudio anidado en el Todos nosotros Programa de investigación para explorar cómo los individuos responden a diferentes dietas. El estudio de NPH es el primer estudio complementario que aprovecha la Todos nosotros infraestructura para responder preguntas científicas importantes para los participantes, como comprender más sobre el papel de la nutrición en la salud. Los estudios de nutrición de alta calidad, como el estudio de NPH, ayudarán a las personas y a sus proveedores de atención médica a crear planes de dieta saludables, precisos y efectivos.

Los objetivos del estudio son:
1. Examinar las diferencias individuales observadas en respuesta a diferentes dietas mediante el estudio de las interacciones entre la dieta, los genes, las proteínas, el microbioma, el metabolismo y otros factores contextuales individuales.
2. Utilizar la inteligencia artificial (IA) para desarrollar algoritmos para predecir las respuestas individuales a los alimentos y los patrones dietéticos.
3. Validar algoritmos para aplicación clínica.

El programa Nutrition for Precision Health incluye varios componentes integrados:

1) Centro Coordinador de Investigación: Proporcionar gestión administrativa y coordinación en todos los sitios.
2) Centros Clínicos: Reclutar, dar consentimiento e inscribir a los participantes de All of Us en nutrición
programa.
3) Centros de generación de datos: a) Realizar análisis genéticos del microbioma del intestino humano b) Realizar análisis metabólicos c) Métodos avanzados de evaluación dietética.
4) Centro de Inteligencia Artificial, Modelado de Datos Multimodal y Bioinformática: Establezca modelos matemáticos y computacionales, desarrolle algoritmos y mejore la visualización de datos.
5) Todos nosotros Biobanco: Reciba, procese y almacene muestras biológicas y metadatos.


Probióticos personalizados de Thryve

Investigación clínica y científica para nuestras formulaciones de cepas

Nuestra fórmula de salud inmunológica contiene Lactobacillus paracasei Th1 y Th2. L. paracasei Th1 también se llama LP33, Th2 se llama AAP-2. Varios estudios clínicos han demostrado que pueden modular el sistema inmunológico aliviando los síntomas de la rinitis alérgica y la dermatitis atópica (Ref 1, Ref 2, Ref 3). Además, nuestra fórmula para el control de peso contiene Lactobacillus reuteri Tr1, que también se llama L. ruteri ADR1. Esta cepa probiótica patentada puede modular la salud metabólica, ayudar a controlar el peso (ref 4, ref 5) y actualmente se encuentra en un ensayo clínico 2017-2018 en (Ref 6).

Nuestra fórmula para la salud digestiva contiene especies de Bacillus, Lactobacillus y Bifidobacterium, ingredientes que se derivan de plantas, productos humanos y lácteos. No contienen gluten y están encapsulados en celulosa vegetal, lo que ayuda a evitar el ácido del estómago.


Microbioma intestinal implicado en el envejecimiento saludable y la longevidad

El microbioma intestinal es un componente integral del cuerpo, pero su importancia en el proceso de envejecimiento humano no está clara. Los investigadores de ISB y sus colaboradores han identificado firmas distintas en el microbioma intestinal que están asociadas con trayectorias de envejecimiento saludables o no saludables, que a su vez predicen la supervivencia en una población de personas mayores. El trabajo está programado para ser publicado en la revista. Metabolismo de la naturaleza.

El equipo de investigación analizó el microbioma intestinal, datos fenotípicos y clínicos de más de 9.000 personas, entre las edades de 18 y 101 años, en tres cohortes independientes. El equipo se centró, en particular, en datos longitudinales de una cohorte de más de 900 personas mayores que viven en la comunidad (78-98 años), lo que les permitió realizar un seguimiento de los resultados de salud y supervivencia.

Los datos mostraron que los microbiomas intestinales se volvieron cada vez más únicos (es decir, cada vez más divergentes de otros) a medida que los individuos envejecían, comenzando en la edad adulta media o tardía, lo que se correspondía con una disminución constante en la abundancia de géneros bacterianos centrales (por ejemplo, Bacteroides) que tienden a ser compartida entre humanos.

Sorprendentemente, mientras que los microbiomas se volvieron cada vez más únicos para cada individuo en un envejecimiento saludable, las funciones metabólicas que los microbiomas estaban llevando a cabo compartían rasgos comunes. Esta firma de singularidad intestinal estaba altamente correlacionada con varios metabolitos derivados de microbios en el plasma sanguíneo, incluido uno, el indol derivado del triptófano, que se ha demostrado anteriormente que prolonga la vida útil en ratones. Los niveles en sangre de otro metabolito, la fenilacetilglutamina, mostraron la asociación más fuerte con la singularidad, y trabajos anteriores han demostrado que este metabolito está muy elevado en la sangre de los centenarios.

"Esta firma de singularidad puede predecir la supervivencia del paciente en las últimas décadas de la vida", dijo el Dr. Tomasz Wilmanski, científico investigador de la ISB, quien dirigió el estudio. Los individuos sanos alrededor de los 80 años de edad mostraron una deriva microbiana continua hacia un estado de composición único, pero esta deriva estuvo ausente en los individuos menos sanos.

"Curiosamente, este patrón de singularidad parece comenzar en la mediana edad, entre los 40 y los 50 años, y está asociado con una clara firma metabolómica de la sangre, lo que sugiere que estos cambios en el microbioma pueden no ser simplemente un diagnóstico de envejecimiento saludable, sino que pueden también contribuyen directamente a la salud a medida que envejecemos ", dijo Wilmanski. Por ejemplo, se sabe que los indoles reducen la inflamación en el intestino y se cree que la inflamación crónica es un factor importante en la progresión de las morbilidades relacionadas con el envejecimiento.

"Los resultados anteriores en la investigación del envejecimiento de los microbiomas parecen inconsistentes, con algunos informes que muestran una disminución en los géneros intestinales centrales en las poblaciones centenarias, mientras que otros muestran una estabilidad relativa del microbioma hasta el inicio de la disminución de la salud relacionada con el envejecimiento", dijo el especialista en microbiomas, el Dr. Sean Gibbons, coautor correspondiente del artículo. "Nuestro trabajo, que es el primero en incorporar un análisis detallado de la salud y la supervivencia, puede resolver estas inconsistencias. Específicamente, mostramos dos trayectorias de envejecimiento distintas: 1) una disminución en los microbios centrales y un aumento en la singularidad de individuos más sanos, consistente con resultados previos en centenarios residentes en la comunidad, y 2) el mantenimiento de microbios centrales en individuos menos sanos ".

Este análisis destaca el hecho de que el microbioma intestinal adulto continúa desarrollándose con la edad avanzada en individuos sanos, pero no en los enfermos, y que las composiciones del microbioma asociadas con la salud en la edad adulta temprana o media pueden no ser compatibles con la salud en la edad adulta tardía.

"Este es un trabajo emocionante que creemos que tendrá importantes implicaciones clínicas para monitorear y modificar la salud del microbioma intestinal a lo largo de la vida de una persona", dijo el profesor de la ISB, el Dr. Nathan Price, coautor correspondiente del artículo.

Este proyecto de investigación fue realizado por ISB y colaboradores de la Universidad de Ciencias y Salud de Oregon, la Universidad de California en San Diego, la Universidad de Pittsburgh, la Universidad de California Davis, el Instituto de Medicina del Estilo de Vida y la Universidad de Washington. Fue apoyado en parte por un Premio Catalizador en Longevidad Saludable de la Academia Nacional de Medicina y el Consorcio de Longevidad del Instituto Nacional sobre el Envejecimiento.


Impacto de la prematuridad y la nutrición en el desarrollo del microbioma intestinal y el crecimiento del lactante prematuro

Fondo: Se necesita con urgencia la identificación de los factores que influyen en el microbioma intestinal neonatal para guiar las prácticas clínicas que apoyan el crecimiento de los recién nacidos prematuros sanos. Aquí, examinamos la influencia de la nutrición y las prácticas comunes en la microbiota intestinal y el crecimiento en una cohorte de bebés prematuros.

Resultados: Con muestras semanales de microbiota intestinal que abarcan la edad posmenstrual (PMA) de 24 a 46 semanas, desarrollamos dos modelos para probar las asociaciones entre la microbiota, la nutrición y el crecimiento: un modelo categórico con tres fases sucesivas de microbiota (P1, P2 y P3) y un modelo con dos períodos (PMA temprano y tardío) definidos por la composición de la microbiota y PMA, respectivamente. Las asociaciones más significativas con la fase nos llevaron a utilizar un marco basado en fases para la mayoría de nuestros análisis. Las transiciones de fase se caracterizaron por cambios rápidos en la microbiota, con la transición de P1 ocurriendo casi simultáneamente con el cambio de meconio a heces normales. La tasa de progresión de la fase se asoció positivamente con la edad gestacional al nacer y el retraso en la transición a una microbiota P3 se asoció con un retraso en el crecimiento. Encontramos distintas funciones metabólicas bacterianas en P1-3 y asociaciones significativas entre la nutrición, la fase de la microbiota y el crecimiento infantil.

Conclusión: El impacto dependiente de la fase de la nutrición en el crecimiento infantil junto con las funciones metabólicas específicas de la fase sugiere un potencial pionero para mejorar los resultados del crecimiento al adaptar la ingesta de nutrientes a la fase de la microbiota.

Palabras clave: Microbiota intestinal Crecimiento infantil Meconio Nutrición Transición de fase Lactantes prematuros.

Declaracion de conflicto de interes

Aprobación ética y consentimiento para participar

Se obtuvo el consentimiento informado por escrito de un padre o tutor de todos los bebés participantes. La junta de revisión institucional de la Facultad de Medicina de la Universidad de Rochester y el Hospital Strong Memorial aprobó el estudio.

Consentimiento para la publicación
Conflicto de intereses

Los autores declaran que no tienen intereses en competencia.

Nota del editor

Springer Nature permanece neutral con respecto a los reclamos jurisdiccionales en mapas publicados y afiliaciones institucionales.

Cifras

Descripción general del lactante prematuro ...

Descripción general de las fases y propiedades de la microbiota intestinal del lactante prematuro. a La decisión…

Distribución temporal de la microbiota intestinal ...

Distribución temporal de las fases de la microbiota intestinal, cambio en el peso del lactante y aclaramiento de meconio.…


Prácticas actuales de evaluación de la dieta y sus limitaciones en los estudios del microbioma de la dieta

El advenimiento y la creciente disponibilidad y asequibilidad de la tecnología de secuenciación ha dado lugar a una explosión de literatura sobre microbiomas dietéticos. Esto se ilustra fácilmente con una búsqueda en PubMed de & # x0201Cdiet & # x0201D y & # x0201Cmicrobiome. & # X0201D En 2009 se publicaron 100 artículos y en 2019 se publicaron 2204 artículos que se identificaron utilizando estos términos de búsqueda. A enero de 2020, hay 9.544 artículos que se devuelven en PubMed utilizando estos términos, y de los que más de la mitad se publicaron en los últimos 3 años. Este aumento en las publicaciones ha ido acompañado de una conciencia cada vez mayor de las limitaciones que enfrentamos al intentar medir y analizar las interacciones altamente complejas entre los microbios, las exposiciones alimentarias y los fenotipos del huésped.

La medición de la ingesta dietética sigue siendo particularmente desafiante. Si bien los métodos de recopilación y análisis de datos del microbioma han mejorado durante la última década, ha habido pocos cambios en el análisis y la recopilación de datos dietéticos y muchos estudios en humanos se basan en cuestionarios de frecuencia de alimentos (FFQ) o registros de alimentos de un solo día autoadministrados. o retiros dietéticos de 24 horas. Cada uno de estos métodos es propenso a informar errores y está asociado con ventajas y desventajas, como se ha revisado ampliamente en otros lugares (35). Es importante destacar que, si bien ciertos enfoques de evaluación dietética pueden ser adecuados para estimar la ingesta calórica total, la diversidad dietética o la ingesta de ciertos alimentos y categorías de alimentos, es posible que no capturen el nivel de detalle necesario para descubrir las relaciones entre la dieta y el microbioma intestinal. Aunque se necesitan desesperadamente métodos mejorados para la recopilación y evaluación de la dieta en los estudios del microbioma para abordar estos problemas, el desarrollo y la adopción de nuevas técnicas de evaluación dietética llevará tiempo. Mientras tanto, se recomienda una consideración cuidadosa de las variables clave al planificar estudios e integrar los datos dietéticos con los resultados del microbioma.

Medir y evaluar con precisión la ingesta dietética mediante el autoinforme y los biomarcadores nutricionales es un desafío (36, 37). Al elegir una técnica de evaluación dietética para un estudio de microbioma, el método seleccionado tendrá un impacto final en las preguntas de investigación que se pueden responder utilizando los datos. Como la mayoría de las decisiones de investigación, para evaluar la dieta es necesario sopesar las opciones en competencia en términos de tiempo, calidad y costo. En este caso, el tiempo incluye tanto el tiempo del investigador para la recopilación y revisión, como el tiempo de respuesta del participante y la carga debido al esfuerzo realizado para registrar la dieta. El tiempo del participante está influenciado por el marco de tiempo del mantenimiento de registros dietéticos. Las evaluaciones dietéticas de baja carga incluyen la administración de un solo recuerdo o registro de 24 horas o un solo FFQ para capturar el historial dietético durante las semanas, meses o años anteriores. Las evaluaciones dietéticas longitudinales más intensivas en tiempo, que utilizan registros diarios detallados durante un período prolongado de semanas, meses o incluso años, tienen una alta carga para los participantes. La calidad se relaciona con la precisión con la que los datos de la evaluación dietética capturan y reflejan la ingesta dietética real, y qué tan bien capturan los datos el nivel de detalle necesario para los resultados relacionados con el microbioma, como la inclusión de sustancias químicas derivadas de la dieta de importancia microbiana en las bases de datos de nutrientes. (38). El costo también es multifactorial, incluido el costo de cualquier software nutricional o dispositivos de recolección de medidas físicas como balanzas y tazas medidoras, hasta el costo del personal capacitado para recolectar o ingresar a los retiros diarios de 24 horas, y el costo necesario para pagar a los participantes para alentar la participación y mantenimiento de registros completo. Por lo general, los investigadores solo pueden elegir dos de estos tres intereses en competencia: tiempo, calidad o costo. Por lo tanto, los investigadores generalmente optan por minimizar la carga de tiempo de los participantes y el costo general a expensas de la calidad. Lo que esto significa en la práctica es que los equipos de investigación utilizan con frecuencia FFQ o controles dietéticos en lugar de métodos que requieren más tiempo y costos, como registros de dietas de varios días o retiros administrados por personal capacitado.

La medición dietética por FFQ tiene ventajas y desventajas (39, 40). La principal ventaja es que los FFQ son convenientes. Son muy fáciles de administrar y requieren menos tiempo de participación que otros métodos. Un participante del estudio simplemente indica la frecuencia con la que consumen alimentos específicos y cuánto consumen, y estas respuestas se utilizan para estimar la ingesta calórica total, así como la ingesta de los principales macronutrientes y micronutrientes. Sin embargo, debido a que las FFQ se desarrollaron para cuantificar patrones dietéticos amplios o índices de alimentación saludable, están limitadas de varias maneras y no pueden capturar la dieta con tanta precisión como otros métodos (41). Aunque lejos de ser óptimos, los patrones dietéticos estimados por FFQ han proporcionado una idea de la forma en que la dieta habitual contribuye a la composición del microbioma La ingesta de nutrientes a largo plazo determinada por FFQ se ha asociado con la composición microbiana, y se han encontrado relaciones entre los patrones dietéticos determinados por FFQ y la abundancia de géneros microbianos (7, 42 & # x0201344). Estos hallazgos han sido respaldados por investigaciones que muestran que los cambios en los patrones dietéticos, ya sea experimentalmente o mediante experimentos naturales que aprovechan los hábitos alimenticios estacionales o la inmigración, afectan la composición del microbioma (45 & # x0201347). Sin embargo, la mayoría de las FFQ no están diseñadas para proporcionar datos que puedan vincular alimentos específicos con cambios específicos en la composición de especies microbianas o vías funcionales.

A pesar de la identificación de algunas señales de los estudios de microbiomas que utilizan FFQ para el análisis dietético, la técnica simplemente no es lo suficientemente específica como para desenredar las complejas relaciones entre los alimentos y el microbioma. Hemos demostrado anteriormente que la composición del microbioma covaría más estrechamente con la ingesta de alimentos, no con la ingesta de nutrientes (6), lo que indica que la dependencia de las variables de composición de nutrientes existentes es insuficiente y que los alimentos en sí son importantes cuando se explora la covariación dieta-microbioma. Sin embargo, incluso los retiros de alimentos de 24 horas y los registros de alimentos bien realizados no logran capturar suficientemente la complejidad de los alimentos de manera significativa para los microbios. Por ejemplo, una marca de pan puede incluir 7 granos integrales diferentes, así como nueces y semillas, mientras que otra marca puede estar hecha con trigo germinado. Durante la entrada en la dieta, ambos panes pueden codificarse como pan de trigo integral y, por lo tanto, el análisis posterior los tratará como idénticos cuando sean diferentes. Esta variación podría contribuir a algunos de los resultados de la dieta-microbioma personalizados que se han informado con respecto a la respuesta de la glucosa en sangre (16, 19).

En los casos en que los investigadores reconocen la necesidad de recopilar información dietética resuelta con mayor precisión, es común en la literatura sobre microbiomas leer sobre técnicas que utilizan cuestionarios sobre alimentos desarrollados por investigadores, métodos de recopilación basados ​​en aplicaciones creados de forma independiente (16, 48) y afrontar herramientas para el análisis de nutrientes en lugar de utilizar técnicas validadas para la recolección dietética o herramientas de análisis de nutrientes desarrolladas con un enfoque de investigación (23). Al recopilar retiros de 24 horas o pedir a los participantes registros de alimentos de 24 horas, la inclusión de personal debidamente capacitado puede mejorar la calidad de los datos. Como mínimo, los participantes que registran su ingesta deben recibir capacitación utilizando ejemplos detallados que muestren el nivel de detalle necesario para completar un registro preciso. Esto debe incluir una discusión sobre los tamaños de las porciones, la especificidad de los ingredientes, los métodos de preparación y la inclusión de alimentos y aditivos comúnmente olvidados. Todos los registros deben ser revisados ​​con el participante con un enfoque en la identificación de alimentos que se notifican erróneamente o que se olvidan comúnmente. Los métodos para la evaluación de la ingesta dietética están mejorando y la tecnología que utiliza recordatorios y registros computarizados puede reducir en gran medida la carga de los investigadores a la hora de recopilar datos dietéticos. Independientemente del método de recopilación, cuando los registros o retiradas se codifican para su análisis utilizando software de investigación dietética, es importante tener en cuenta la coherencia con la entrada de datos, la codificación y la limpieza de los datos dietéticos para permitir un análisis sólido de la composición de nutrientes y la ingesta de alimentos en sentido descendente.

En el entorno actual de recopilación de registros dietéticos, las diferentes herramientas de recopilación de alimentos y FFQ se basan en diferentes bases de datos subyacentes, lo que hace que la comparación entre estudios y cohortes sea difícil, si no casi imposible. Incluso dentro de las regiones de habla inglesa de las Américas, el Reino Unido y Australasia, los registros de alimentos se asignan en última instancia a diferentes bases de datos según las herramientas de software utilizadas para el análisis (49). Cada base de datos proporciona datos sobre la composición de nutrientes, pero la fuente de esos datos varía. Los métodos de análisis para nutrientes específicos también pueden variar según la base de datos, lo que conduce a diferentes resultados de niveles de nutrientes en bases de datos de diferentes países. Más allá de la composición de nutrientes, las convenciones de nomenclatura utilizadas para identificar los alimentos no son idénticas en las bases de datos, lo que genera problemas al comparar los datos recopilados con diferentes herramientas. Además, las estructuras de agrupación de alimentos varían, sin que se adopte un método universalmente aceptado en todos los estudios o bases de datos. Se están realizando esfuerzos para establecer una ontología alimentaria compartida que pueda armonizar los datos dietéticos recopilados en diferentes regiones del mundo y mediante diferentes herramientas, incorporando otras características de los alimentos, como el método de preparación (50). Los métodos de preparación y cocción de alimentos alteran las propiedades químicas de los alimentos, como los cambios que se producen en las batatas durante la cocción, que luego impactan los efectos de ese alimento en el microbioma (51), agregando otra capa de complejidad a la medición de la dieta. Es probable que la matriz alimentaria (52) desempeñe un papel importante en la relación entre la dieta y el microbioma y también debe tenerse en cuenta. La información específica, como la madurez de las frutas, no se captura actualmente en ninguna base de datos de alimentos. Sin embargo, este nivel de detalle puede ser muy relevante para ciertas interacciones entre alimentos y microbios. Por ejemplo, se sabe que cuando los plátanos no están maduros o verdes, el almidón que contienen es almidón resistente (53), que es fermentable por microbios, mientras que en los plátanos maduros ese almidón resistente se ha descompuesto en moléculas más simples de almidón y glucosa, que son absorbible por el huésped, y ya no proporciona ningún sustrato fermentable para los microbios intestinales. Más allá de la preparación y madurez de los alimentos, una investigación reciente que aborda los comportamientos alimentarios en torno a los alimentos ultraprocesados ​​muestra que controlar solo el contenido de energía y macronutrientes puede ser insuficiente para las intervenciones dietéticas (54). Es probable que también deban tenerse en cuenta los métodos de obtención, elaboración o cocción de los alimentos (51), los aditivos o emulsionantes (55, 56), los edulcorantes artificiales (57) y los métodos agrícolas convencionales u orgánicos (58).

Además de los cambios en el microbioma inducidos por los componentes bioquímicos de los alimentos, los propios alimentos contienen bacterias que afectan el microbioma intestinal. Desde una perspectiva de la salud, los productos lácteos fermentados, como el yogur y los quesos, son los alimentos más comúnmente reconocidos que contienen microbios & # x0201Cbeneficiales & # x0201D (59). Estos alimentos son fuentes de microbios que pueden poblar transitoriamente el intestino humano (23). Los alimentos frescos no fermentados han sido reconocidos durante mucho tiempo como una fuente de patógenos transmitidos por los alimentos y son el objetivo de las intervenciones de salud pública para prevenir la propagación de enfermedades transmitidas por los alimentos. A pesar de este reconocimiento, sabemos sorprendentemente poco sobre la composición microbiana en otros alimentos no fermentados. Recientemente, se ha demostrado que los cultivos que no suelen transferir bacterias, como las manzanas, albergan un microbioma que depende del crecimiento y las prácticas agrícolas (58). De hecho, los patrones dietéticos que incluyen más tipos de alimentos, en particular los alimentos fermentados como el yogur, contienen una mayor abundancia de microbios en comparación con las dietas menos diversas (1 & # x000D7 10 9 unidades formadoras de colonias [UFC] frente a 1 & # x000D7 10 6 UFC en al día & # x00027s por valor de comidas) (60). La consideración de la carga microbiana de un patrón dietético es importante porque el injerto de bacterias no patógenas transmitidas por los alimentos depende, en parte, de otros componentes dietéticos. Por ejemplo, hay una mayor abundancia de bacterias asociadas al queso parmesano después del consumo de productos lácteos (61). Idealmente, debemos considerar estas características microbianas de la dieta al planificar y analizar los estudios de microbioma-dieta.


Tecnologías avanzadas para el reconocimiento de imágenes de alimentos en la evaluación de la ingesta de nutrientes

La evaluación dietética es un paso crucial en la implementación en el mundo real de cualquier programa de nutrición personalizado. La capacidad de un individuo para rastrear su ingesta de alimentos juega un papel en el autocontrol como un aspecto crítico del cambio de comportamiento (Referencia Peterson, Middleton y Nackers 88). También puede proporcionar a un dietista profesional información sobre cómo un cliente se está adhiriendo a su plan de alimentación individualizado. Sin embargo, evaluar la ingesta dietética con métodos tradicionales conlleva costos y una carga considerables para el individuo. Estos métodos también son propensos a errores, ya que a menudo se basan en la autoevaluación (Reference Burrows, Ho y Rollo 89).

Se necesitan soluciones avanzadas para cuantificar objetivamente la ingesta de alimentos y bebidas (Referencia Mezgec, Eftimov y Bucher 90). El reconocimiento de imágenes de alimentos es una estrategia prometedora porque la mayoría de las personas poseen un teléfono inteligente con cámara, por lo que la barrera de entrada es baja y puede llegar a una gran población. Sin embargo, reconocer automáticamente los alimentos a partir de las imágenes es un problema desafiante de la visión por computadora debido a una variedad de problemas: (1) los alimentos son típicamente objetos deformables, (2) los alimentos pueden perder su información visual durante la preparación, (3) diferentes alimentos pueden aparecer visualmente similar, (4) el mismo alimento puede aparecer de manera diferente dependiendo de la iluminación o el ángulo y (5) cantidad limitada de información visual para bebidas (Referencia Mezgec y Koroušić Seljak 91). Solo después de que los alimentos se reconozcan visualmente, se pueden vincular de manera confiable a una base de datos de composición de alimentos (Referencia Eftimov, Korošec y Koroušić Seljak 92).

La introducción del conjunto de datos de imágenes de comida rápida de Pittsburgh en 2009 facilitó la investigación inicial en esta área basada en métodos de reconocimiento manual, pero estos enfoques lograron en su mayoría solo una precisión de clasificación del 10-40% (Referencia Chen, Dhingra y Wu 93, Referencia Yang, Chen y Pomerleau 94). En 2014, el aprendizaje profundo se utilizó por primera vez para reconocer imágenes de alimentos. El aprendizaje profundo, o redes neuronales profundas, permite que los modelos computacionales compuestos de múltiples capas de procesamiento aprendan características de imagen relevantes a través del entrenamiento en un conjunto de imágenes de entrada (Referencia LeCun, Bengio y Hinton 95, Referencia Deng y Yu 96). Las redes neuronales convolucionales profundas están inspiradas en el sistema visual de los animales, donde las neuronas individuales evalúan la entrada visual reaccionando a regiones superpuestas en el campo visual (Referencia Hubel y Wiesel 97). Debido a que pueden clasificar cada píxel de la imagen, pueden reconocer cualquier cantidad de elementos, junto con su ubicación y tamaño, lo que permite estimar el volumen y el peso de los alimentos. Este enfoque ha logrado resultados sustancialmente mejores que otros métodos, lo que ha dado como resultado un mayor enfoque en el aprendizaje profundo en investigaciones recientes (Referencia Zhou, Zhang y Liu 98, Referencia Knez y Šajn 99).

Mezgec y Koroušić Seljak han desarrollado una nueva arquitectura de aprendizaje profundo para el reconocimiento de imágenes de alimentos, llamada NutriNet (Referencia Mezgec y Koroušić Seljak 91). Es una modificación de la conocida arquitectura AlexNet (Referencia Krizhevsky, Sutskever, Hinton, Pereira, Burges y Bottou 100), con un tamaño de imagen aumentado y una capa convolucional adicional al comienzo de la red neuronal (Referencia Mezgec y Koroušić Seljak 91 ). NutriNet se capacitó por primera vez en 225 953 imágenes disponibles gratuitamente que se descargaron de Internet y se organizaron en clases de alimentos apropiadas (520 alimentos únicos). Cuando se probó con tres arquitecturas de aprendizaje profundo populares de la época (AlexNet (Referencia Krizhevsky, Sutskever, Hinton, Pereira, Burges y Bottou 100), GoogLeNet (Referencia Szegedy, Wei y Yangqing 101) y ResNet (Referencia He, Zhang y Ren 102) ), Se descubrió que NutriNet es superior a AlexNet y GoogLeNet y más rápido de entrenar que las otras tres arquitecturas. Luego, el enfoque de aprendizaje profundo se utilizó para reconocer cualquier cantidad de elementos en una sola imagen de comida utilizando un conjunto de entrenamiento obtenido del "buffet de comida falsa" (Referencia Bucher, van der Horst y Siegrist 103), que es visualmente similar a la comida real. Redes totalmente convolucionales, introducidas por Long et al. (Reference Long, Shelhamer y Darrell 104), se aplicaron para realizar la segmentación semántica, dividiendo la imagen en partes lógicas y clasificando cada parte a nivel de píxel. Due to the complexity of food images, an fully convolutional network variant that can segment images at the finest grain (fully convolutional network-8s) ( Reference Long, Shelhamer and Darrell 104) was used to train a model on the fake food buffet image data set. Output predictions of the trained model were compared with the ground-truth labels using the pixel accuracy measure ( Reference Long, Shelhamer and Darrell 104) , and the final accuracy of the trained fully convolutional network-8s model was 92·18 %.

In recent years, deep learning has been validated numerous times as a suitable solution for recognising food images ( Reference Zhou, Zhang and Liu 98) . Availability of food image data sets has been improving ( Reference Ciocca, Napoletano and Schettini 105– Reference Cai, Li and Li 107) , although there is a need for validation against data sets from different regions across the world. Future work will focus on real-world food images, which exhibit more variance compared with the test images used in the research environment. In the future, such technology could be used to improve dietary assessment in clinical trials. For example, it can play a role in human studies in the areas mentioned above, where accurate quantification of folate, vitamin B12 and energetic intake is critical. Consumer wellness apps can also apply this solution in the future, improving the dietary assessment of individuals and facilitating self-monitoring towards positive behaviour change.


Genetics or lifestyle: What is it that shapes our microbiome?

The question of nature vs nurture extends to our microbiome -- the personal complement of mostly-friendly bacteria we carry around with us. Study after study has found that our microbiome affects nearly every aspect of our health and its microbial composition, which varies from individual to individual, may hold the key to everything from weight gain to moods. Some microbiome researchers had suggested that this variation begins with differences in our genes but a large-scale study conducted at the Weizmann Institute of Science challenges this idea and provides evidence that the connection between microbiome and health may be even more important than we thought.

Indeed, the working hypothesis has been that genetics plays a major role in determining microbiome variation among people. According to this view, our genes determine the environment our microbiome occupies, and each particular environment allows certain bacterial strains to thrive. However, the Weizmann researchers were surprised to discover that the host's genetics play a very minor role in determining microbiome composition -- only accounting for about 2% of the variation between populations.

The research was led by research students Daphna Rothschild, Dr. Omer Weissbrod and Dr. Elad Barkan from the lab of Prof. Eran Segal of the Computer Science and Applied Mathematics Department, together with members of Prof. Eran Elinav's group of the Immunology Department, all at the Weizmann Institute of Science. Their findings, which were recently published in Naturaleza, were based on a unique database of around 1,000 Israelis who had participated in a longitudinal study of personalized nutrition. Israel has a highly diverse population, which presents an ideal experimental setting for investigating the effects of genetic differences. In addition to genetic data and microbiome composition, the information collected for each study participant included dietary habits, lifestyle, medications and additional measurements. The scientists analyzing this data concluded that diet and lifestyle are by far the most dominant factors shaping our microbiome composition.

If microbiome populations are not shaped by our genetics, how do they nonetheless interact with our genes to modify our health? The scientists investigated the connections between microbiome and the measurements in the database of cholesterol, weight, blood glucose levels, and other clinical parameters. The study results were very surprising: For most of these clinical measures, the association with bacterial genomes was at least as strong, and in some cases stronger, than the association with the host's human genome.

According to the scientists, these findings provide solid evidence that understanding the factors that shape our microbiome may be key to understanding and treating many common health problems.

Segal: "We cannot change our genes, but we now know that we can affect -- and even reshape -- the composition of the different kinds of bacteria we host in our bodies. So the findings of our research are quite hopeful they suggest that our microbiome could be a powerful means for improving our health."

The field of microbiome research is relatively young the database of 1,000 individuals collected at the Weizmann institute is one of the most extensive in the world. Segal and Elinav believe that over time, with the further addition of data to their study and those of others, these recent findings may be further validated, and the connection between our microbiome, our genetics and our health will become clearer.


This is an excerpt from Environmental Microbiology Reports, 2015, authored by Arjun Raman, a postdoc in the Baliga Lab here at Institute for Systems Biology. The beauty of a living thing is not the atoms that go into it, but the way those atoms are put together. Information distilled over four billion years of biological evolution. Incidentally, all the organisms on the Earth are made essentially of that stuff. An…


Métodos

Clinical methods

All study procedures were approved by the University of Rochester School of Medicine Internal Review Board (IRB) (Protocol # 37933). Infants included in the study were from the multicenter Prematurity and Respiratory Outcomes Program (PROP) and the Respiratory Pathogens Research Center (RPRC) at the University of Rochester School of Medicine and were cared for in a single-center Newborn Intensive Care Unit (NICU). Clinical care in terms of type and duration of antibiotic treatment, corticosteroids, diuretics, motility agents, and H2 receptor agonists as well as the timing and volume of feeds was at the discretion of treating physicians. Rectal swabs were used to collect fecal material from consented infants from 24 PMA until discharge and again at 6 months and 1 year for preterms and birth and 1 month for full terms. Each sample was collected by inserting a sterile Copan flocked nylon swab (Copan Diagnostics, Murrieta, CA) moistened with normal saline beyond the sphincters into the rectum and then twirled. Each sample was immediately placed into sterile buffered saline and stored at 4 °C for no more than 4 h. Samples were processed daily, which involved extraction of the fecal material from the swab in a sterile environment and immediately frozen at − 80 °C until DNA extraction. All sampling swabs, plasticware, buffers, and reagents used for sample collection and extraction of nucleic acids were sterile and UV-irradiated to insure no contamination from sources outside of the infant and sample.

Derived medication and nutrition variables

For all medications considered, binary variables were derived for each sample that indicate whether or not a given medication was administered in the week (7 days) prior to sample collection. Weight Z-score was computed as a proxy for growth. First, weight percentile was computed as the percentage of weight measures of a population of the same sex and age that fall below the observed weight value. We applied Cole’s LMS method as used by CDC and WHO [54]. The standard growth chart is based on sex-matched premature infant population weight data collected by Fenton and Kim [55, 56]. Weight Z-scores were computed based on the corresponding weight percentiles. Four variables associated with each sample were derived for nutritional intake: total calories per kilogram in the week prior to sample collection, ratio of lipids or proteins in the week prior to sample collection, and the ratio of total calories in the week prior to sample collection that were consumed enterally (as opposed to parenterally). These values were computed based on detailed daily feeding records and the available nutrition facts for all formulas, supplements, and total parenteral nutrient preparations used in the NICU. Total calories per kilogram in the past week is the sum of total calories per kilogram per day for the 7 days prior to sampling. The proportion of enteral calories computed as the ratio of (grams of lipids/protein per kilogram) divided by (total calories per kilogram) for each day, summed over the 7 days prior to sampling. “Enteral calorie ratio past week” was computed as the total calories per kilogram consumed enterally in the week prior to sampling divided by the total calories per kilogram consumed (enterally and parenterally) in the same period.

Genomic DNA extraction

Total genomic DNA was extracted with a modified method using the QIAGEN Fecal DNA kit and FastPrep mechanical lysis (MPBio, Solon, OH). 16S ribosomal RNA (rRNA) was amplified with Phusion High-Fidelity polymerase (Thermo Scientific, Waltham, MA) and dual indexed primers specific to the V3-V4 hypervariable regions (319F: 5′ ACTCCTACGGGAGGCAGCAG 3′ 806R: 3′ ACTCCTACGGGAGGCAGCAG 5′) [57]. Amplicons were pooled and paired-end sequenced on an Illumina MiSeq (Illumina, San Diego, CA) in the University of Rochester Genomics Research Center. Each sequencing run included (1) positive controls consisting of a 1:5 mixture of Staphylococcus aureus, Lactococcus lactis, Porphyromonas gingivalis, Streptococcus mutans, y Escherichia coli and (2) negative controls consisting of sterile saline.

16S rRNA sequence processing

Raw data from the Illumina MiSeq was first converted into FASTQ format 2 × 300 paired-end sequence files using the bcl2fastq program, version 1.8.4, provided by Illumina. Format conversion was performed without de-multiplexing and the EAMMS algorithm was disabled. All other settings were default. Sequence processing and microbial composition analysis were performed with the Quantitative Insights into Microbial Ecology (QIIME) software package [58], version 1.9. Reads were multiplexed using a configuration described previously [57]. Briefly, for both reads in a pair, the first 12 bases were a barcode, which was followed by a primer, then a heterogeneity spacer, and then the target 16S rRNA sequence. Using a custom Python script, the barcodes from each read pair were removed, concatenated together, and stored in a separate file. Read pairs were assembled using fastq-join from the ea.-utils package, requiring at least 40 bases of overlap and allowing a maximum of 10% mismatched bases. Read pairs that could not be assembled were discarded. The concatenated barcode sequences were prepended to the corresponding assembled reads, and the resulting sequences were converted from FASTQ to FASTA and QUAL files for QIIME analysis. Barcodes, forward primer, spacer, and reverse primer sequences were removed during de-multiplexing. Reads containing more than four mismatches to the known primer sequences or more than three mismatches to all barcode sequences were excluded from subsequent processing and analysis. Assembled reads were truncated at the beginning of the first 30 base window with a mean Phred quality score of less than 20 or at the first ambiguous base, whichever came first. Resulting sequences shorter than 300 bases or containing a homopolymer longer than six bases were discarded. Operational taxonomic units (OTU) were picked using the reference-based USEARCH (version 5.2) [59] pipeline in QIIME, using the May 2013 release of the GreenGenes 99% OTU database as a closed reference [60, 61]. An indexed word length of 128 and otherwise default parameters were used with USEARCH. Chimera detection was performed de novo with UCHIME, using default parameters [59]. OTU clusters with less than four sequences were removed, and representative sequences used to make taxonomic assignments for each cluster were selected on the basis of abundance. The RDP Naïve Bayesian Classifier was used for taxonomic classification with the GreenGenes reference database, using a minimum confidence threshold of .85 and otherwise default parameters [62]. Phylogenetic investigation of communities by reconstruction of unobserved states (PICRUSt) [63] was used with the provided pre-processed KEGG Orthologs database to infer the putative functional capacities of these communities.

16S rRNA microbiota data pre-processing

To ensure the quality of statistical analysis, microbiome samples with < 12,000 total reads were excluded from the subsequent data analyses. Microbiota abundance data were summarized at six different levels (level 2: PHYLUM–level 7: SPECIES). For characterization of the microbiota phases and within phase abundance analyses, raw relative abundance values were used. For beta diversity calculations, normalization by rarefaction at a depth of 12,000 reads was performed. For longitudinal abundance analyses, at each taxonomic level we excluded OTU units (taxa) with equal or more than 98% of exactly zero reads among the 705 samples. In total, 140 genera and 198 species are used for these statistical analyses. The abundance data were log2 transformed (log2(X + 1)) following normalization by cumulative sum scaling [64].

Description of decision tree logic to define microbiota phases

Drawing on the microbial dysbiosis index described by Gevers et al. [65], the first step in the decision tree is to compute and evaluate the log of (total abundance of the classes increased in prematurity (Bacilos + Gammaproteobacteria)) over (total abundance of the class decreased in prematurity (Clostridios)). If this value is less than or equal to two, the gut microbiota is defined as being in phase 3. If the result of the first step in the tree is greater than two, a second step is taken where we compute and evaluate the log of (total abundance of the class increased in extreme prematurity (Bacilos)) over (total abundance of the class decreased in extreme prematurity (Gammaproteobacteria)). If the resulting value is less than or equal to two, the gut microbiota is defined as being in phase two otherwise, it is defined as being in phase one (P1). In the event that the ratio is non-computable because Clostridios is entirely absent and the P1|P2 branch is taken, or the P1|P2 branch is taken and Gammaproteobacteria is absent, the microbiota is defined as being in P1 or the P1|P2 branch is taken and Bacilos is absent, the microbiota is defined as being in P2. If two of the three classes are absent, the microbiota is defined as being in the phase characterized by the class that is present. No samples were entirely devoid of all three classes, but such a case could not be resolved within this framework. Dirichlet multinomial mixture (DMM) modeling for comparative purposes was performed using the Dirichlet multinomial R package, which is based on Holmes et al. [66]. Class-level composition was used, and per sample normalization was performed by converting relative abundances to counts summing to 12,000 (the minimum read threshold for inclusion in analysis). The dmn function was used with default parameters and an arbitrary seed value of 11 count data was fit to one through ten Dirichlet components, and model fit was estimated using the Laplace metric.

Functional capacity of microbiota phases

The functional capacity of the microbiota present in each sample was inferred using PICRUSt (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States) [63], which reconstructs the functional composition of a microbial community sample using 16S rRNA phylogeny and a database of annotated reference genomes. For each functional pathway from the Kyoto Encyclopedia of Genes and Genomes (KEGG) that was putatively identified, comparisons were made between the phases using LEfSe, which identifies features that are statistically differentially abundant among biological classes (in this case phases) and then performs comparative tests between pairs of biological classes to identify where these features are significantly enriched or diminished.

Comparing taxonomic composition, functional capacity, and week-to-week dissimilarity between phases

Analysis of variance of taxa abundance at all taxonomic levels across the three phases of the microbiota was conducted using a Kruskal-Wallis test, and the results are summarized in Additional file 4: Table S3. Differential abundance of taxa between each pair of two phases was assessed at each taxonomic level using the metagenomicsSeq zero-inflated Gaussian test [64], and the results are summarized in Additional file 5: Tables S4A–C. Testing for differential functional capacity between the phases was performed using LEfSe [67] with per-sample normalization to 1 M total counts, minimum effect size of 2.0, alpha of 0.1, an all-against-all strategy, and otherwise default parameters. The results are summarized in Additional file 6: Table S5. An exploratory test of the equality of the median of the week-to-week differences of samples within individual subjects between the cases where the phase remains the same and the cases where the phase changes was performed using the Wilcoxon rank-sum test. los pag value reported for this test is approximate due to the paired nature of beta-diversity and the presence of repeated measures from the same subjects.

Transition from meconium to solid stool

The point of stool transition from meconium to normal as described in the text was determined from nurses’ records subjectively characterizing diaper contents when they were changed. These records were available as free text and each entry was time stamped, with one entry for every time a diaper was changed. Stool transition was defined as the first such record without the word meconium that was followed by no more than two records containing the word meconium. To assess the associations between day of life (DOL) of stool transition and day of life of initial transition out of phase one, a simple linear regression model was used with DOL of transition out of phase 1, gestational age at birth as covariates, and DOL of stool transition as the outcome. A similar regression model was used to assess the association between growth and time to reach phase 3. The DOL of the first phase 3 sample observed for each subject and their gestational age at birth were used as covariates, and the total change in weight Z-score from birth to discharge was used as the outcome variable. This model included only the 81 subjects who reached phase three prior to discharge.

Determination of early and late time periods

We applied functional principal component analysis to the microbiota abundance data [21]. The estimated temporal abundance function of taxon v y tema I, ( >_(t) ) , was represented by a linear combination of eigen-functions as follows:

Here, ( >_v(t) ) is the estimated mean curve for the vth taxon, ξ k, v(t) es el kth eigen-function for this taxon, K v is the number of top eigen-functions needed to explain ≥ 99% of total functional variation, and C ik, v are the linear coefficients. On average, it takes 2.93 functional principal components to explain ≥ 99% of total variation at the species level. We calculated the total functional variance based on the fitted microbiota abundance at the species level. More specifically, we computed the pointwise variance function for each species from the smoothed temporal curves of abundance at the species level, then took the summation over all species used in this study

Here, ( >_(t) ) represents the sample mean abundance function calculated from all subjects. ( overline(t) ) represents the overall temporal variance at the species level. The maximum of ( overline(t) ) occurred at PMA = 34 weeks (rounded to integers), which is illustrated in Additional file 2: Figure S5. Based on this cutoff, we define the EARLY period of PMA to be (0,34) and the LATE period to be [34,∞). The EARLY interval has 362 data points the LATE interval has 343 data points.

Association between clinical variables and microbiota abundance in each phase

Within each phase independently, association testing between all taxa and clinical and nutritional factors of interest was performed by regressing the relative abundance of each taxon on these covariates: gestational age at birth, post menstrual age, total calories per kilogram in the past week, ratio of lipids in the past week, ratio of proteins in the past week, ratio of carbohydrates in the past week, proportion of total calories received enterally in the past week, whether antibiotics were received in the past week, whether diuretics were received in the past week, whether corticosteroids were received in the past week, whether motility agents were received in the past week, whether proton pump inhibitors were received in the past week, and whether H2 receptor antagonists were received in the past week. This was done using the MaAsLin algorithm [68] with subject as a random variable, without model selection, and with otherwise default parameters. The results are summarized in Additional file 7: Table S6.

Association between nutrition/medication and growth

We performed linear mixed-effect regression analysis similar to the above model on both early and late periods (Model A) and three phases (Model B) to test the association between the nutrition/medication factors (as covariates) and weight Z-score as a proxy for growth (as the response variables). We included gaBirth (gestational age at birth) and PMA in the model to control for their possible confounding effects. More specifically, the following two linear mixed-effects regressions were performed.

Here, NutriMed(I,k) (t j) es el kth clinical covariate for the Ith subject measured at the jth time point. β k is the corresponding linear coefficient (fixed effect) α I is a random-effect term that quantifies the within-subject dependence and ϵ ij es el I.I.D. measurement error. In summary, model A associates weight Z-score to the time periods (EARLY versus LATE), nutrition and medication variables, and their interactions. Model B is much like model A except that it uses microbiota phases to quantify the developmental stages of microbial community instead. For model A, LATE is considered as the baseline phase (coded as 0) and EARLY is coded as 1. For model B, phase 3 is considered as the baseline phase (coded as 0) phases 1 and 2 are coded as 1 in two separate binary variables. The interactions included in both models are defined as the products of the nutrition/medication variables and period/phase-related covariates. The significance of associations is determined by regression t test with Satterthwaite’s approximation. Due to the use of large number of covariates in these models, stepwise model selection based on the Akaike information criterion (AIC) was used to reduce model complexity. The results of model B for weight Z-score are summarized in Table 2 of the main text. As an example, the linear associations of P2 and percent lipids * P2 with the weight z-score are both significant (beta = − 0.7766 for P2 and 5.658 for lipids * P2) meaning that while P2 is correlated with a smaller weight z-score as compared with the baseline (P3), a higher percent of lipid intake for P2 subjects increases the weight Z-scores for subjects in P2. Analyses were performed in R 3.2.0 (R Foundation for Statistical Computing, Vienna, Austria).

Predicting microbiome phases

We performed a mixed-effects logistic regression analyses to study the associations between a host of nutrition- and medication-related covariates and the three microbiota phases on the early and late intervals. We considered P3 as the baseline phase and represented P1 and P2 by two separate binary outcome variables. Gestational age at birth and PMA were included to control for their potential confounding effects. A likelihood ratio test was used to determine the statistical significance of associations. The results are summarized in Tables 3A and B.