Información

2.6: Endorreduplicación - Biología

2.6: Endorreduplicación - Biología


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Endoreduplicación, es un tipo especial de amplificación del genoma específico de tejido que se produce en muchos tipos de células vegetales y en células especializadas de algunos animales, incluidos los humanos. Un ejemplo es el altamente endorreduplicado glándula salival polietileno cromosomas de D. melanogaster (Figura ( PageIndex {21} )) que puede tener más de 1000 cromátidas que se alinean y forman cromosomas gigantes que muestran un patrón de bandas que refleja la secuencia de ADN y los genes subyacentes en esa región cromosómica. Estos cromosomas han sido maravillosos modelos de investigación en genética, ya que su tamaño relativamente grande y amplificado facilita la identificación y el estudio de una amplia variedad de aberraciones cromosómicas bajo el microscopio.

Figura ( PageIndex {21} ): Cromosomas endoreduplicados de una célula de la glándula salival de Drosophila. El patrón de bandas se produce con etiquetas fluorescentes (Flickr-Elissa Lei, Ph.D. @ NIH-CCA).


2.6: Endorreduplicación - Biología

En primer lugar, su campo de investigación fue la citogenética vegetal, principalmente en relación con la replicación del ADN y el ciclo celular. Los intercambios de cromátidas hermanas y las aberraciones cromosómicas fueron los criterios de valoración elegidos. Tras una estancia de seis años como investigador en el Consejo Superior de Investigaciones Científicas (Madrid), en 1980 se traslada a la Universidad de Sevilla, donde crea su propio equipo de investigación interesado en el daño del ADN inducido por diferentes mutágenos ambientales así como por el mecanismos celulares que se ocupan de tal daño. Si bien hasta 1985 las células vegetales habían sido casi exclusivamente el material empleado, ese año se trasladó a la Universidad de Uppsala (Suecia), y más tarde a la Universidad de San Francisco en California (EE. UU.) Para familiarizarse con las metodologías de cultivo celular in vitro. para células de mamíferos y humanos.

Asume el Director del equipo de investigación de Cultivo Celular y Radiobiología cuyo laboratorio de la Facultad de Biología de Sevilla (España) está comprometido con una actualización continua de objetivos y metodologías como resultado de los contactos con científicos a nivel mundial así como de colaboraciones e intercambios con otros laboratorios. . Hasta ahora sus principales áreas de investigación utilizando células de mamífero cultivadas han sido las siguientes: estudios de protección radiológica realizados en el marco de Proyectos Coordinados de la Unión Europea, mecanismos implicados en aberraciones cromosómicas e intercambio de cromátidas hermanas (para la detección de daño en el ADN), posible participación de diferentes enzimas nucleares (principalmente ADN topoisomerasas I y II) en la reparación de ADN dañado, daño genotóxico en aves del Parque Nacional Do & ntildeana (suroeste de España) como consecuencia del vertido de residuos tóxicos mineros al río Guadiamar y, entre otros, ensayos de extractos de plantas andaluzas y latinoamericanas en cuanto a su posible actividad antitumoral. El Dr. F.Cort & eacutes es el autor de 3 libros de texto sobre histología vegetal y es miembro del Consejo Editorial de Mutation Research (Elsevier).

Cantero G, Campanella C, Mateos S, Cortes F.
Inhibición de la topoisomerasa II y alto rendimiento de endorreduplicación inducida por los flavonoides luteolina y quercetina.
Mutagénesis. 21 de septiembre de 2006 (5): 321-5. Epub 2006 1 de septiembre.
PMID: 16950806 [PubMed - indexado para MEDLINE] ------

Cantero G, Pastor N, Mateos S, Campanella C, Cortes F.
Endorreduplicación inducida por cisplatino en células CHO: daño del ADN e inhibición de la topoisomerasa II.
Mutat Res. 2006 julio 25599 (1-2): 160-6. Publicación electrónica 30 de marzo de 2006.
PMID: 16574165 [PubMed - indexado para MEDLINE] ------

Mateos S, Hajji N, Pastor N, Cortes F.
Modulación de la respuesta a la radiación mediante la inhibición de la actividad catalítica de la topoisomerasa II.
Mutat Res. 2006 julio 25599 (1-2): 105-15. Publicación electrónica 30 de marzo de 2006.
PMID: 16574164 [PubMed - indexado para MEDLINE] ------

Cantero G, Mateos S, Pastor N, Cortes F.
La sustitución de ADN por halógeno protege del envenenamiento de la topoisomerasa II que resulta en roturas de doble cadena del ADN.
Reparación de ADN (Amst). 2006 junio 105 (6): 667-74. Epub 2006 10 de enero.
PMID: 16406738 [PubMed - indexado para MEDLINE] ------

Lopez-Lazaro M, Pastor N, Azrak SS, Ayuso MJ, Cortes F, Austin CA.
La digitoxina, en concentraciones que se encuentran comúnmente en el plasma de pacientes cardíacos, antagoniza la actividad del etopósido y la idarrubicina en las células leucémicas K562.
Leuk Res. 30 de julio de 2006 (7): 895-8. Epub 2006 4 de enero.
PMID: 16387358 [PubMed - en proceso] ------

Lopez-Lazaro M, Pastor N, Azrak SS, Ayuso MJ, Austin CA, Cortes F.
La digitoxina inhibe el crecimiento de líneas de células cancerosas en concentraciones que se encuentran comúnmente en pacientes cardíacos.
J Nat Prod. 2005 noviembre 68 (11): 1642-5.
PMID: 16309315 [PubMed - indexado para MEDLINE]

Cort & eacutes Benavides, Felipe
La naturaleza del ADN. Determina una correcta segregaci & oacuten de los cromosomas en la mitosis
Investigaci & oacuten y Ciencia, Junio ​​2005, pag 35-36. ------

Mateos S, Dom & iacutenguez I, Pastor N, Cantero G, Cortes F.
El ADN que desmetila 5-azaC induce endorreduplicación en células cultivadas de hámster chino.
Mutat Res. Octubre de 2005 de 15578 (1-2): 33-42. Epub 2005 23 de marzo.
PMID: 16202795 [PubMed - indexado para MEDLINE]] ------

Hajji N, Mateos S, Pastor N, Domínguez I, Cortes F.
Inducción de daño genotóxico y citotóxico por aclarubicina, un inhibidor dual de la topoisomerasa.
Mutat Res. 2005 mayo 2583 (1): 26-35.
PMID: 15866463 [PubMed - indexado para MEDLINE] ------

Pastor N, Cantero G, Campanella C, Cortes F.
Endorreduplicación inducida en células cultivadas de hámster chino por diferentes sustancias químicas anti-topoisomerasa II. Evidencia de la contribución esencial de la enzima a la segregación cromosómica.
Mutat Res. 2005 abril 4582 (1-2): 11-9. Epub 2005 24 de enero.
PMID: 15781205 [PubMed - indexado para MEDLINE] ------

Cortes F, Mateos S, Pastor N, Domínguez I.
Hacia un modelo integral de endorreduplicación inducida.
Life Sci. 2004 noviembre 2676 (2): 121-35. Revisar.
PMID: 15519359 [PubMed - indexado para MEDLINE] ------

Hajji N, Pastor N, Mateos S, Dominguez I, Cortes F.
Roturas de la hebra de ADN inducidas por la anti-topoisomerasa II bis-dioxopiperazina ICRF-193.
Mutat Res. 29530 de septiembre de 2003 (1-2): 35-46.
PMID: 14563529 [PubMed - indexado para MEDLINE] ------

Cortes F, Pastor N, Mateos S, Domínguez I.
La naturaleza del ADN juega un papel en la segregación cromosómica: endorreduplicación en cromosomas sustituidos con halógeno.
Reparación de ADN (Amst). 112 de junio de 2003 (6): 719-26.
PMID: 12767350 [PubMed - indexado para MEDLINE] ------

Pastor N, Jose Flores M, Dominguez I, Mateos S, Cortes F.
Alto rendimiento de endorreduplicación inducida por ICRF-193: un inhibidor catalítico de la topoisomerasa II.
Mutat Res. 2002 Abril 26516 (1-2): 113-20.
PMID: 11943617 [PubMed - indexado para MEDLINE] ------

Pastor N, Domínguez I, Mateos S, Cortes F.
Un estudio comparativo de los efectos genotóxicos de los fármacos anti-topoisomerasa II ICRF-193 y bufalina en células de ovario de hámster chino.
Mutat Res. 2002 Mar 25515 (1-2): 171-80.
PMID: 11909765 [PubMed - indexado para MEDLINE] ------

Domínguez I, Pastor N, Mateos S, Cortes F.
Prueba del mecanismo SCE con inhibidores de la topoisomerasa II no intoxicantes.
Mutat Res. 2001 Oct 18497 (1-2): 71-9.
PMID: 11525909 [PubMed - indexado para MEDLINE] ------

Domínguez I, Mateos S, Cortes F.
Artículos relacionados, enlaces
Rendimiento de SCE y translocaciones producidas por 3 aminobenzamida en células cultivadas de hámster chino.
Mutat Res. 2000 Mar 14448 (1): 29-34.
PMID: 10751620 [PubMed - indexado para MEDLINE] ------


2.6: Endorreduplicación - Biología

Endoreduplicación, es un tipo especial de amplificación del genoma específico de tejido que se produce en muchos tipos de células vegetales y en células especializadas de algunos animales, incluidos los humanos. La endorreduplicación no afecta la línea germinal ni los gametos, por lo que las especies con endorreduplicación no se consideran poliploides. La endorreduplicación ocurre cuando una célula se somete a rondas adicionales de síntesis de ADN (fase S) sin mitosis o citocinesis para producir una célula endopoliploide. Esto produce múltiples cromátidas de cada cromosoma. La endopoliploidía parece estar asociada con células que son metabólicamente muy activas y producen muchas enzimas y otras proteínas en un corto período de tiempo. Un ejemplo es la glándula salival altamente endorreduplicada. polietileno cromosomas de D. melanogaster (Figura 2.17) que puede tener más de 1000 cromátidas que se alinean y forman un patrón de bandas único que refleja la secuencia de ADN y los genes en esa región cromosómica. Estos cromosomas han sido modelos de investigación útiles en genética, ya que su tamaño relativamente grande facilita la identificación y el estudio de las aberraciones cromosómicas bajo el microscopio.

El software CuboCube es de código abierto. El código fuente está disponible en nuestro repositorio público de Github.


Abstracto

Los resultados para la mayoría de los pacientes con mieloma han mejorado en las últimas décadas gracias a los avances en el tratamiento. Sin embargo, hay un subconjunto de pacientes que se considera que tienen una enfermedad de alto riesgo y que no se han beneficiado. Comprender cómo evolucionan las enfermedades de alto riesgo a partir de etapas más tratables terapéuticamente es crucial si queremos mejorar los resultados. Esto se puede lograr identificando los mecanismos genéticos y las mutaciones que impulsan la transición de una célula plasmática normal a una con las características de las siguientes etapas de la enfermedad: gammapatía monoclonal de significado indeterminado, mieloma latente, mieloma y leucemia de células plasmáticas. Aunque los eventos que inician el mieloma son clonales, las lesiones impulsoras posteriores a menudo ocurren en un subclon de células, lo que facilita la progresión mediante procesos de selección darwinianos. Comprender la evolución conjunta de los clones dentro de su microambiente será crucial para manipular terapéuticamente el proceso. La etapa final de la progresión es la generación de un estado asociado con la resistencia al tratamiento, el aumento de la proliferación, la evasión de la apoptosis y la capacidad de crecer independientemente del microambiente de la médula ósea. En esta revisión, discutimos estos estados de enfermedad de alto riesgo en etapa terminal y cómo la nueva información está mejorando nuestra comprensión de sus trayectorias evolutivas, cómo se pueden diagnosticar y el comportamiento biológico que debe abordarse si se quiere tratar de manera efectiva.


3. ¿Cuándo se descubrieron los JA y se estableció su función como hormonas?

En 1899 Hesse y Müller purificaron una cetona desconocida de Jasminum grandiflorum extractos de aceite esencial y lo llamó jasmona [13]. Su estructura química fue resuelta en 1933 por Ruzicka y Pfeiffer [14]. Sin embargo, jasmona purificada, combinada con otros compuestos conocidos también aislados de Jasminum aceite esencial, no tenía el aroma característico de las flores de jazmín, lo que sugiere que faltaban uno o más componentes. En 1962, finalmente se aisló el jasmonato de metilo y se determinó su estructura, y se demostró que era la molécula odorífera que faltaba [15]. Pasaron otros 20 años antes de que los biólogos observaran que los JA tenían efectos sobre la senescencia de las hojas y el crecimiento de las plántulas [16, 17]. La identificación de la vía biosintética JA ya estaba casi completa en 1992 [18], mientras que la primera A. thaliana Mutante resistente a JA, coi1 (para CORONATINE INSENSITIVE 1), fue aislado en 1994 [19]. El gen fue clonado en 1998 [20] y formalmente identificado como el único (hasta ahora) receptor JA 11 años después [21, 22].


Materiales y métodos

Inactivación del locus XRCC3 en HCT116

Se insertaron genes de resistencia a fármacos sin promotores en el Exón 3 en el marco. Se amplificó un elemento de dirección 5 'de 1,5 kb a partir del ADN isogénico de células HCT116 usando I1-1 (5'-TGCGAGGTTCATACTCC-3') y E3-2A (5'-GCATCGATGCAAATCCATTTTGTCGG-3 '). Se amplificó un elemento de direccionamiento 3 'de 3,0 kb utilizando E3-1 (5'-TACTGGACCTGAATCCCAGA-3') e I4-1 (5'-ATGGAAACCTTGTCCGTCCA-3 '). Ambos elementos se clonaron en pCR2.1 (Invitrogen) mediante el método de clonación TA. El elemento 3 ′ se cortó con KpnDigesté y subcloné en el KpnMe sitúo en el vector que contiene el elemento 5 ′. Se amplificó un casete de resistencia a neomicina a partir de pMC1neo-polyA (Stratagene) usando Cla4neo1 (5'-CTATCGATGTATGGGATCGGCCATT-3 ') y neo8cla2 (5'-TCATCGATGAAGCTTGGCTGCAGGT-3'). Se amplificó un casete de resistencia a higromicina a partir de pcDNA / Hygro (Invitrogen) usando ClaI-hyg (5′-CTATCGATGTATGAAAAAGCCT-3 ′) e hig-ClaI (5′-TCATCGATGAGGCTTTACACTTT-3 ′). El casete de resistencia a los medicamentos se insertó en el ClaSitio del vector que contiene ambos elementos en el marco. Se ha descrito un método para experimentos de knockout en HCT116 (Miyagawa et al, 2002). El anticuerpo anti-XRCC3 se obtuvo de Chemicon.

Expresión del gen XRCC3

El humano XRCC3 Los ADNc se amplificaron a partir de ADNc derivado de sangre normal usando E3-5 (5'-CCTCCCACAGGCTTTGAATT-3 ') y 3UTR-1 (5'-GAAGAGCTGTGTCTGAACCA-3'). Los ADNc se insertaron en pCR2.1 y se confirmó la secuencia. los XRCC3 Los ADNc se insertaron cadena abajo del potenciador de MSV y del promotor de MMTV. Se transfectaron células deficientes en XRCC3 con los vectores y se seleccionaron en presencia de 900 µg / ml de zeocina (Invitrogen). La sobreexpresión de XRCC3 en células que sobreexpresan RPA se realizó utilizando los mismos vectores y pKO SelectPuro (Lexicon Genetics), porque las células que sobreexpresan RPA ya habían sido transfectadas con genes de resistencia a zeocina. Las células que sobreexpresan XRCC3 se aislaron mediante PCR utilizando cebadores específicos para los vectores de expresión.

Tasa de crecimiento y sensibilidad a los agentes que dañan el ADN.

Las células se trataron con MMC (Kyowa-Hakko) en suspensión durante 10 min, se lavaron dos veces con solución salina tamponada con fosfato (PBS) y se sembraron en placas a una densidad de 2 x 103 células por placa de 60 mm. Después de 7 días de cultivo, se contaron las colonias. La sensibilidad a la radiación ionizante y la tasa de crecimiento se midieron como se describe (Miyagawa et al, 2002 ).

Medición de las frecuencias de recombinación homóloga y formación de focos Rad51

Métodos para la medición de los niveles de SCE y la frecuencia de integración objetivo en el RAD54B locus han sido descritos, y que para el RAD51C locus fue modificado (Miyagawa et al, 2002). Para mejorar la frecuencia de orientación en el RAD51C locus, los elementos de dirección 5 'y 3' se amplificaron a partir de ADN isogénico. La formación del foco Rad51 se examinó como se describió anteriormente (Tashiro et al, 2000 ).

Análisis FISH

Las sondas centroméricas específicas de cromosoma se obtuvieron de Vysis. El ADN de las células se desnaturalizó en formamida al 70% / 2 x SSC a 72ºC durante 1,5 min. La hibridación se realizó en tampón de hibridación CEP (Vysis) a 37 ° C durante 48 h. Los portaobjetos se lavaron en formamida al 50% / 2 x SSC a 45 ° C durante 5 min dos veces y en 2 x SSC a 45 ° C durante 5 min dos veces. El ADN celular se tiñó con DAPI.

Análisis del ciclo celular

Para medir el índice mitótico, se añadió nocodazol al medio de cultivo hasta una concentración final de 200 ng / ml. Las células se recolectaron a intervalos de tiempo de 6 h, se fijaron en etanol al 70% y se tiñeron con Hoechst 33258. Para medir el contenido de ADN, las células cultivadas en presencia de 100 ng / ml de nocodazol se tomaron en los puntos de tiempo indicados, se lavaron tres veces con PBS. y fijado en etanol al 70%. Las células fijadas se trataron con 500 μg / ml de RNasaA durante 30 min a 37 ° C y se añadió yoduro de propidio hasta una concentración final de 50 μg / ml. La citometría de flujo se realizó utilizando un calibre FACS (Becton Dickinson).

Inmunoprecipitación

Los extractos celulares se prepararon en tampón de lisis (Tris-HCl 50 mM, pH 7,5, NaCl 100 mM, EDTA 5 mM, pH 8,0, Nonidet P-40 al 0,5%, PMSF 1 mM, aprotinina 20 μg / ml, leupeptina 10 μg / ml , 300 U Kunitz / ml de DNasa I), se incubaron durante 30 min en hielo y se lisaron mediante sonicación. El material insoluble se eliminó mediante centrifugación a alta velocidad. El extracto de células enteras fue aclarado previamente con IgG de ratón normal y 15 µl de agarosa de proteína G recombinante (Invitrogen). Las muestras se incubaron con anticuerpos durante 1 ha 4 ° C. Para cada muestra, se agregaron 15 μl de agarosa de proteína G y las muestras se incubaron durante 1 ha 4 ° C y se lavaron seis veces con tampón de lavado (Tris-HCl 50 mM, pH 7,5, NaCl 100 mM, EDTA 5 mM , pH 8,0, Nonidet P-40 al 0,5%, PMSF 1 mM). Los complejos se visualizaron mediante análisis de transferencia Western. Los anticuerpos anti-RPA32 (12F3.3) y anti-RPA14 (11.1) se obtuvieron de GeneTex. El anticuerpo Anit-RPA70 (C-21) se obtuvo de Santa Cruz Biotechnology. El anticuerpo anti-Rad51C se obtuvo de Chemicon. Los anticuerpos anti-XRCC3 (165-100) y anti-Rad52 (H-300) se obtuvieron de Novus Biologicals y Santa Cruz Biotechnology, respectivamente.

Expresión transitoria en células COS7

los XRCC3 ADNc y el RPA Los ADNc se clonaron en pcDNA3.1 (Invitrogen). los RAD52 El ADNc se clonó en pcDNA3.1 / Hygro. Los plásmidos se transfectaron usando Superfect Transfection Reagent (Qiagen) de acuerdo con las instrucciones del fabricante. Las células cultivadas durante 48 h después de la transfección se recogieron en tampón de lisis.

Expresión de los genes RPA

Los ADNc de RPA humano se amplificaron a partir de ADNc derivado de sangre normal. Se utilizaron los siguientes cebadores para la amplificación de los genes RPA: RPA70 5 ′ cebador con sentido (5′-AAGTCTTGGCGGTGGAGCCA-3 ′) RPA70 3 ′ cebador antisentido (5′-AAATCGATTCCATTCTGCC-3 ′) RPA32 5 ′ cebador con sentido (5′- TCGGCCTCTTTGCGGAGAAT-3 ′) RPA32 3 ′ cebador antisentido (5′-GATTGTGAAACTAGGTCC-3 ′) RPA14 5 ′ cebador con sentido (5′-AGCCGCAGTCTTGGACCATA-3 ′) RPA14 3 ′A-3 ′ AAGCACT. Los ADNc se insertaron en pCR2.1 y se confirmó la secuencia. Los ADNc de RPA se insertaron cadena abajo del potenciador de MSV y del promotor de MMTV. Se transfectaron células HCT116 con los vectores y se seleccionaron en presencia de 900 µg / ml de zeocina.

Expresión de los genes RAD52 y RAD51C

El humano RAD52 El ADNc se clonó a partir de una biblioteca de ADNc de testículo humano (Clontech) y se insertó cadena abajo del potenciador de MSV y del promotor de MMTV. Células que sobreexpresan RPA14 y XRCC3 Las células - / - se transfectaron con los vectores que contenían genes de resistencia a fármacos y se seleccionaron en presencia de 200 µg / ml de higromicina y 900 µg / ml de zeocina, respectivamente. El mutante que expresa la proteína variante XRCC3 se transfectó con el RAD52 vector de expresión y pKO SelectPuro, y se seleccionó en presencia de 1,25 µg / ml de puromicina porque las células mutantes ya habían sido transfectadas con genes de resistencia a higromicina y zeocina. El mutante que sobreexpresa Rad52 se aisló mediante PCR utilizando cebadores específicos del vector de expresión. El humano RAD51C El ADNc se amplificó a partir de ADNc derivado de sangre normal. El cDNA se insertó en el mismo vector y se introdujo en XRCC3 - / - celdas. La selección se realizó en presencia de 900 µg / ml de zeocina.


Métodos

Métodos y cepas generales

Las cepas se cultivaron utilizando métodos estándar [10] y se mantuvieron a 20 ° C. La cepa Bristol N2 se utilizó como cepa estándar de tipo salvaje en todos los experimentos. Todos los cruces se llevaron a cabo de acuerdo con métodos estándar [37]. Los alelos mutantes utilizados se enumeran a continuación por grupo de enlace (LG) y han sido descritos por [10] a menos que se indique lo contrario: (LGII): sma-6 (1482), (LGIII): lon-1 (e185), (LGV): lon-8 (hu187), lon-8 (hu188), (este estudio), lon-3 (e2175), dbl-1 (nk3) [16], him-5 (e1490), (LGX): lon-2 (e678). En este estudio se utilizaron las siguientes líneas transgénicas: BW1940 ctIs40 [dbl-1xs] [17], JR667 wIs51 [22], KN746 huEx96 (este estudio), KN905 huEx129 (este estudio).

Secuenciación de lon-8

Para amplificar el lon-8 ADNc de una biblioteca de ADNc de dos híbridos de levadura (un regalo de M. Walhout y M. Vidal) utilizamos un cebador dirigido al lado 5 'del poliengarce pPC86 con el lon-8 cebador CTGCAGAATTACTGACTGTTGGGATC y un cebador dirigido al lado 3 'de pPC86 con el lon-8 imprimación CAGTCAGTAATTGCG-GATTTG. Todos los productos amplificados se purificaron y secuenciaron desde ambas direcciones para obtener la longitud completa lon-8 Secuencia de ADNc.

Para secuenciar el lon-8 transcripción presente en tipo salvaje y hu187 animales, utilizamos 1 μg de ARN total de N2 y hu187 (ver más abajo) para generar ADNc por RT-PCR usando un cebador oligo-dT. Luego ampliamos el lon-8 ADNc usando cebadores para la secuencia SL1 y CTGCAGATTCCTCGCTTTCGCTG correspondiente al extremo 3 'del cuarto exón de lon-8 y secuenciaron los productos purificados de ambas direcciones para obtener el tipo salvaje y hu187 Secuencias de ADNc.

Aislamiento y caracterización de lon-8alelos

Los alelos de deleción lon-8 (hu187) y lon-8 (hu188) se generaron mediante la construcción y selección de una biblioteca de deleciones como se describe en [38]. Los cebadores utilizados para identificar y secuenciar el hu187 alelo de deleción fueron TGCAATAGGTGTACGAAAAG y CCACAACACATACATTCCAT como el par externo y GAGTGGAATGCTAATAGGGA y GTGAAGCAGCGTATCAACTA como el par interno. Los cebadores utilizados para identificar y secuenciar el hu188 alelo de deleción fueron TTTTCTTTGAGCCGCAAAAT y CAGGTAACGCCATGAGGAAT como el par externo y CAAAGGAGGTCGAAAGTGGA y CCATTCTGGCAGTGATCTCC como el par interno.

Medidas del tamaño del cuerpo

Las cepas se sincronizaron lavando suavemente placas de 9 cm de una población en etapa mixta para eliminar todos los adultos y larvas, dejando los huevos sin eclosionar. Una hora más tarde, las placas se lavaron suavemente para recoger las larvas eclosionadas dentro de este intervalo. Para la curva de crecimiento, los animales sincronizados se mantuvieron a 20 ° C y se utilizó una placa de cada cepa para las mediciones en cada momento. Cada vez se muestrearon un mínimo de 75 animales al azar. Para el análisis epistático se tomó un control de N2 junto con cada sincronización para asegurar resultados consistentes ya que el tamaño corporal puede variar debido a condiciones externas como la humedad [11]. Para medir, los animales se montaron en portaobjetos de agarosa al 2% que contenían azida sódica 10 mM y se fotografiaron inmediatamente con un aumento de 33,5 veces utilizando un microscopio Zeiss Axioplan2 y una cámara digital Axiovision adjunta. La longitud del cuerpo se determinó utilizando el software Object Image 2.13. Los datos se analizaron utilizando GraphPad Prism.

Lon-8p :: gfpconstrucciones de fusión

Para generar el Plon-8 :: gfp construcción de fusión pGS25, secuencia correspondiente a la región cadena arriba de 2 kb hasta el segundo exón de la predicción lon-8 La transcripción se amplificó a partir de ADN genómico N2 utilizando cebadores (PstI) -CTTGACCGTAGAGCTTCC y (PstI) -CAAATCCGCAATTACTGACTG. Este fragmento se clonó en el vector de inserción pPD95.69 GFP (A. Fire, comunicación personal) utilizando el PstI clonación del sitio. Para generar la construcción que excluye el péptido señal predicho, pGS26, se amplificaron dos fragmentos de pGS25: el clonado lon-8 secuencia arriba hasta el ATG predicho usando el cebador inverso (BglII) -ATTCCTCATGGCGTTAC, y un fragmento que consiste en el final del primer exón hasta el comienzo del segundo exón utilizando el cebador directo (BglII) -AGTGAGTTGTTTAC. Los fragmentos digeridos se ligaron simultáneamente en pPD95.69 usando el PstI clonación del sitio.

Ambas construcciones de fusión se inyectaron a una concentración de 50 ng / μl en dpy-20 (e1282) y animales N2 que utilizan 50 ng / μl de pMH86 (que contiene dpy-20) o 20 ng / μl de pPY20 (P.T. Yang, comunicación personal) como marcadores de coinyección. pPY20 (Pmyo-2 :: tomate) expresa la proteína de tomate roja fluorescente [39] en la faringe. Se generaron varias líneas que mostraban patrones de expresión similares. huEx96 y huEx129 fueron seleccionados para un análisis más detallado.

Manchas del norte

El ARN total se obtuvo de poblaciones de N2 en etapas mixtas, lon-8 (hu187), lon-8 (hu188), lon-1 (e185), ctIs40 [dbl-1xs], dbl-1 (nk3) y sma-6 (e1482). Los animales se lisaron durante 5 minutos a 60ºC en tampón que contenía 2 mg / ml de proteinasa K. Se aisló ARN usando Trizol LS (Invitrogen) seguido de extracción con cloroformo y precipitación con isopropanol. Se cargaron 10 µg de ARN total en cada carril de un gel de formaldehído al 6%. Después de la electroforesis, el ARN se transfirió a la membrana Bio-Rad Zeta-Probe. los lon-8 La sonda se generó amplificando la lon-8 transcripción de una biblioteca de ADNc utilizando los cebadores CCCGGGCATGAGGAATTCGCGGTT y CCCGGGTATGATATGGAATTATCG. los lon-1 La sonda se generó amplificando un fragmento de 250 pb del exón 6 del ADN genómico de N2 utilizando los cebadores GATGCCAGCTTTCACCTG y CTCTCATTCGGAACCCGTC. los eft-2 La sonda se generó amplificando un fragmento de 400 pb del exón 4 del ADN genómico de N2 utilizando los cebadores GCACAATCGTCTTCACTGTACC y GTAAGAACCGAAGCGTAGAAC.

Medición de endorreduplicación

Sincronizamos poblaciones de N2, lon-1 (e185), y lon-8 (hu187) como se describió anteriormente. Después de 120 horas, los animales se recogieron y se fijaron en solución de Carnoy durante la noche. A continuación, los animales se tiñeron con DAPI y se analizaron como se describe [2], o se tiñeron con PI y se analizaron inmediatamente mediante microscopía confocal como se describe [23]. Para cada animal, hicimos una pila confocal del área de la cola entre los núcleos de células de unión V5.ppppp y V6.ppppp. El contenido de ADN de todos los núcleos hipodérmicos ubicados entre estas células de la veta (8 núcleos por animal) se midió como se define por la suma de la intensidad de PI. Luego dividimos este número por el promedio de la intensidad de PI de al menos cuatro núcleos neuronales del cordón nervioso ventral de la misma pila confocal para obtener una proporción promedio de contenido de ADN hipodérmico a neuronal para cada animal.

Experimentos de ARNi

Los clones bacterianos que expresan dsRNA de genes seleccionados se seleccionaron de la biblioteca de ARNi del laboratorio de Ahringer [40]. Cincuenta de tipo salvaje o lon-8 (hu187) Las larvas L4 se colocaron en placas que contenían vector vacío, lon-8, dpy-11 o dpy-18 Bacterias que expresan dsRNA, se cultivaron durante la noche a 15 ° C y se transfirieron a placas frescas de RNAi. Las poblaciones se sincronizaron retirando los animales después de 7 horas, dejando la progenie sin eclosionar. Estos animales se cultivaron a 15 ° C durante 190 horas, lo que equivale a 120 horas de crecimiento a 20 ° C [41], luego se recogieron y midieron como se describe anteriormente.


Opciones de acceso

Obtenga acceso completo a la revista durante 1 año

Todos los precios son precios NETOS.
El IVA se agregará más adelante en el proceso de pago.
El cálculo de impuestos se finalizará durante el pago.

Obtenga acceso a artículos por tiempo limitado o completo en ReadCube.

Todos los precios son precios NETOS.


Sinopsis

El perfil profundo del transcriptoma y el proteoma durante el desarrollo de la hoja revela respuestas inesperadas al déficit de agua, así como una sorprendente falta de fluctuaciones en el nivel de proteínas durante el ciclo día-noche, a pesar de los claros cambios en el nivel de la transcripción.

  • Los patrones de variación de transcripciones y proteínas reflejan las etapas funcionales de la hoja.
  • Los niveles de proteína y transcripción se correlacionan bien durante el desarrollo de la hoja, con algunas excepciones notables.
  • Las fluctuaciones diurnas del nivel de transcripción no se corresponden con las correspondientes fluctuaciones diurnas en el proteoma detectado.
  • La reducción continua del contenido de agua del suelo da como resultado una reducción del crecimiento de las hojas, pero la planta se adapta a niveles moleculares sin mostrar una respuesta típica a la sequía.

Métodos

Identificacion de SMR genes en el maíz

Para identificar el SMR genes en el genoma de referencia B73 (RefGen_v4), utilizamos el informe Arabidopsis Secuencias de aminoácidos SIM / SMR [48] como consultas en una búsqueda BLASTP contra todas las proteínas de maíz descargadas de la base de datos Phytozome utilizando un valor e de 1e-5 y una identidad del 50% como umbrales. Las palabras clave “maíz SIM” y “maíz SMR” se utilizaron como consultas para buscar en la base de datos de proteínas del NCBI. Los resultados de búsqueda de BLASTP y de la base de datos se compararon y analizaron mediante edición manual. Además, se realizó un BLASTN de su propio genoma en maizeGDB para encontrar posibles modelos de genes faltantes. También se realizó una autoexploración de estas secuencias para eliminar las secuencias redundantes, y luego las secuencias restantes se enviaron al servidor web NCBI-CDD para confirmar la presencia e integridad de los dominios conservados. Después de la corrección manual, se obtuvieron las supuestas proteínas ZmSMR. Luego se utilizó la herramienta Expasy ProtParam (https://web.expasy.org/protparam/) y Softberry-ProtComp Versión 9.0 (http://www.softberry.com/berry.phtml) para determinar los parámetros fisicoquímicos y la localización subcelular de las proteínas SMR de maíz, respectivamente.

Elementos reguladores en la región promotora de ZmSMR

Una secuencia de ADN de 1,5 kb corriente arriba del codón de iniciación (ATG) de cada ZmSMR se descargó de la base de datos Phytozome [53]. El sitio de inicio de la transcripción se designó como + 1. Los elementos en los fragmentos del promotor (de - 1500 pb a + 1 pb) del ZmSMR Los genes se identificaron utilizando PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [53, 54], PlantPan 2.0 (http://plantpan2.itps.ncku.edu.tw) [ 55] y RegSite Database of Plant Regulatory Elements - Programa en línea Softberry (http://www.softberry.com/berry.phtml) [56, 57].

Identificación de genes sinténicos

Las relaciones sinténicas de los genes del maíz se identificaron comparando las secuencias del genoma B73 del maíz utilizando la utilidad SynMap [58] del sitio web de CoGe (https://genomevolution.org/coge/). Los genes sinténicos se detectaron utilizando datos de CDS con la configuración predeterminada, excepto el algoritmo Quota Align Merge, y la salida final del conjunto de genes sinténicos con enlaces GEvo se descargó para su análisis posterior [59].

Análisis filogenético y análisis de motivos conservados

La alineación de múltiples secuencias de las secuencias de proteínas de longitud completa de ZmSMR se realizó usando ClustalW integrado en MEGA 7.0 con parámetros predeterminados. La reconstrucción filogenética se realizó con MEGA 6.0 utilizando el método de unión de vecinos con 1000 réplicas de arranque [60]. Estudiar la relación filogenética de las proteínas SMR en Z. mays, A. thaliana, O. sativa, S. bicolor, S. italica, B. distachyon, G. max, P. trichocarpa y P. patens, las secuencias de aa SMR de longitud completa se recuperaron de las bases de datos NCBI y Phytozome. Además, se realizó un BLAST de su propio genoma para estos genes adquiridos para encontrar posibles modelos de genes faltantes. Se realizó una alineación de múltiples secuencias y se representó un árbol sin raíces como se describió anteriormente. Además, para examinar más a fondo la diversidad de composiciones de motivos en las supuestas proteínas ZmSMR, se utilizó un software de búsqueda en línea de maximización de múltiples expectativas para la provocación de motivos (MEME) [61] para predecir los motivos conservados en estas proteínas. El número máximo de motivos se estableció en seis [62].

Muestreo de semillas a diferentes tasas de llenado de grano y DAP

El maízZ. mays L.) La línea endogámica B73 fue proporcionada por el Laboratorio Clave de Biología y Mejoramiento Genético del Maíz en Áreas Áridas de la Región Noroeste, Ministerio de Agricultura, Facultad de Agronomía, Universidad Northwest A & ampF. Las líneas se cultivaron en el campo en el verano de 2012 en Yangling, Shaanxi, China. Las orejas se autopolinizaron el mismo día. El endospermo de la semilla en la misma posición en las mazorcas de maíz se recogió cada 5 días de 0 a 30 DAP (5 DAP para semillas enteras), se congeló en nitrógeno líquido y luego se almacenó en un congelador a -80 ° C. Se aisló ARN de una porción de las semillas y se usó para probar la expresión relativa de SMR genes durante el desarrollo del endospermo del maíz. El resto de las semillas se mantuvieron a 105 ° C durante media hora para desactivarlas y luego se secaron hasta un peso constante a 80 ° C. La tasa de llenado de granos se calculó dividiendo el incremento de peso de cien granos por el número de días y granos entre dos etapas de llenado de granos adyacentes [16]. Se realizaron tres réplicas biológicas en el análisis qRT-PCR.

Condiciones de crecimiento de las plantas y tratamientos contra el estrés.

Las semillas de la línea endogámica de maíz B73 se sumergieron en 10% de H2O2 durante 30 min para desinfectar y luego se trataron con CaSO3 al 3% durante 3 h para promover la germinación. Las semillas tratadas se cultivaron en solución de Hoagland en un invernadero bajo un ciclo de luz de 14 horas y de oscuridad de 10 horas a 23 ± 1 ° C. Leaves were collected from maize seedlings at the three-leaf stage and were then used in the expression profiling of ZmSMR genes under ABA, heat, cold, salt, and drought stresses. For heat and cold stress, the maize seedlings were placed in 42 °C and 4 °C environments, respectively. The maize seedlings were immersed in a 100 μM ABA solution for hormone treatment. For these three stresses, the leaves from the seedlings were collected after 2, 6, 12, and 24 h. The solutions for salt and drought treatments were prepared by adding NaCl (200 Mm/L) and PEG [20% (m/v)] to full-strength Hoagland’s solution, respectively. Both treatments lasted 12 h, 24 h, 48 h, and 72 h. Control check (CK) seedlings were kept in the unstressed growth conditions. Three biological replicates were performed in the qRT-PCR analysis.

RNA isolation and quantitative real-time PCR

Total RNA was extracted using the TaKaRa MiniBEST Plant RNA Extraction Kit (Takara, Dalian, China). RNase-free DNase-I was used to remove any contaminating genomic DNA in the solution. First-strand cDNA synthesis was conducted using a FastQuant RT Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. The qRT-PCR analysis of all 12 ZmSMRs was performed using primers that were designed according to the ZmSMRs’ sequences and using an NCBI Primer-BLAST online instrument (Additional file 11). The amplification products were controlled within a size range of 130 bp to 250 bp (Additional file 11). The maize actina (Zm00001d013873) gene was used as an internal control. All primers were synthesized by Sangon Biotech Company. The qRT-PCR assays were performed in optical 96-well plates with three technical replicates using the BIO-RAD CFX96 Detection System (Bio-Rad, CA, USA). Each reaction was performed in 20 μL of a SuperReal Premix Plus (SYBR Green) reaction mixture (TIANGEN, Beijing, China), following the manufacturer’s instructions. The relative expression ratio of each gene was calculated using the 2 - △ △ CT method [63].