Información

¿Cómo se convierte el ARN de los retrovirus en ADNc?

¿Cómo se convierte el ARN de los retrovirus en ADNc?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

El retrovirus (oncovirus) contiene ARN. También tiene una molécula llamada transcriptasa inversa. Esta molécula transcribe ARN en ADNc. Este ADNc es la copia del ADN del genoma del ARN viral.

El ARN tiene uracilo en lugar de timina y el ADN tiene timina en lugar de uracilo. Entonces, ¿cómo se puede convertir el ARN en ADN? ¿A dónde va Uracil y de dónde viene la timina?


El ARN tiene uracilo en lugar de timina y el ADN tiene timina en lugar de uracilo. Entonces, ¿cómo se puede convertir el ARN en ADN?

Creo que es posible que desee hacer una pregunta más básica. El ADN y el ARN son extremadamente similares, siendo solo el oxígeno la diferencia. Esto tiene vastas consecuencias para los organismos, y la vida tal como la conocemos utiliza ADN y ARN para propósitos muy distintos. El ADN almacena el genoma proporcionando las instrucciones para la vida, y el ARN, en pocas palabras, es la forma en que ese mensaje se convierte en proteína para una acción útil. El ARN es generalmente menos estable que el ADN, por lo que esta disposición funciona bien.

El ADN se transcribe de manera regular y constante a ARN, por lo que la timina se usa regularmente a favor del uracilo. Hay un fantástico responda aquí en Biología.SE ya se ocupa de por qué así que sugiero leer eso. los cómo es bastante sencillo, ¡se utilizan diferentes moléculas! Las ADN polimerasas incorporan timina, mientras que las ARN polimerasas incorporan uracilo. La transcriptasa inversa codificada por el retrovirus hace exactamente esto: transcribe ARN a ADN, utilizando timina en lugar de uracilo. Tanto el uracilo como la timina están presentes en la célula y, por lo tanto, están disponibles para su uso.


Creo que podría ser útil para mostrarle la diferencia entre uracilo y timina.

Son estructuras muy similares. La parte que está involucrada en el emparejamiento de bases es en realidad el nitrógeno y el oxígeno más alejado del azúcar. Vea abajo:

Entonces, tener un grupo metilo adicional en el otro lado de la molécula no interrumpe el emparejamiento de bases. Y recuerde, con la síntesis de ADN / ARN tiene una plantilla, y la nueva hebra se basa en la plantilla. Entonces, cuando la enzima RT que menciona Medhat encuentra una adenina en el ARN molde, la emparejará con una timidina. Y cuando encuentra un uracilo, puede emparejarlo con una adenina. La enzima está estructurada específicamente para permitir solo la timina y no el uracilo, que es como hace la distinción.


Síntesis de ADNc

Sean cuales sean sus requisitos, existe un kit de síntesis de ADNc de Bio-Rad que se adapta a sus necesidades.

Síntesis de ADNc de Reliance Select
Equipo

Seleccione el kit de síntesis de ADNc Reliance Select para capturar objetivos ricos en GC y estructura secundaria en FFPE y muestras difíciles con ARN degradado o inhibidores.

Supermezcla de transcripción inversa
para RT-qPCR

Elija la supermezcla de transcripción inversa iScript para una síntesis de ADNc rápida, eficiente y sensible para RT-qPCR y ndash un solo tubo y un protocolo de 40 minutos.

Kit avanzado de síntesis de ADNc
para RT-qPCR

Elija el kit de síntesis de ADNc avanzado iScript que tiene un rango dinámico extendido con una capacidad de hasta 7.5 & microg de ARN de entrada.


¿Cómo se convierte el ARN de retrovirus en ADNc? - biología

Esta enzima transcriptasa inversa nos permite utilizar una plantilla de ARN para producir una copia de ADNc de doble hebra. La transcriptasa inversa fue descubierta por H. Temin y D. Baltimore mientras estudiaban retrovirus. Los retrovirus contienen un genoma de ARN que se convierte en una copia de ADN y se integra en el genoma del huésped durante su ciclo de replicación. Este es un conjunto interesante de virus que incluye muchos virus tumorales y el virus del SIDA VIH.

La transcriptasa inversa es una ADN polimerasa dependiente de ARN. Utiliza ARN como plantilla, requiere dNTP y un cebador (3 'OH libre) para iniciar la polimerización del ADN.

Normalmente se utilizan dos tipos de imprimación.

Oligo-dT inicia el cebado desde el extremo 3 'de los ARNm.
Los ADNc cebados con oligo-dT están enriquecidos para los extremos 3 'del ARNm.

Los oligonucleótidos aleatorios pueden hibridar en cualquier lugar a lo largo de la secuencia de ARNm y cebar la síntesis de ADNc. Los ADNc cebados aleatoriamente se distribuyen a lo largo de la plantilla y, por lo tanto, son más representativos de la población de ARNm.

Los ARNm son típicamente cortos (en comparación con el genoma): la mayoría de los ARNm tienen menos de 6 kb de longitud y solo los ARNm raros superan los 10 kb de longitud.
Este pequeño tamaño significa que tanto los vectores de inserción de plásmidos como de fagos son apropiados para la construcción de bibliotecas de ADNc.
(a diferencia de las bibliotecas genómicas en las que se prefieren los vectores de sustitución de fagos).

En nuestra discusión de las bibliotecas genómicas, nos centramos en la cobertura completa del genoma.
Se generaron fragmentos genómicos aleatorios mediante digestión parcial con una enzima de corte frecuente.
La biblioteca de escopeta aleatoria resultante contiene múltiples clones superpuestos que cubren la secuencia completa del genoma.

Las bibliotecas de ADNc son un poco diferentes.
Aquí, cada transformante bacteriano o fago empaquetado representa una molécula de ARNm única.
Los recombinantes que contienen la misma secuencia de ADN representan diferentes moléculas molde presentes en la población de ARNm original.

Por ejemplo, hay 100,000 moléculas de ARNm en la célula en un momento dado.
El 10% de ellos son ARNm altamente expresados ​​(digamos ARNm de actina)
luego en una biblioteca de cDNA primaria que consta de 100.000 clones,
El 10% de ellos (10.000) serán ADNc de actina.
O simplemente podría analizar un par de cDNAs y aún así encontrar cDNA de actina.

Bueno, eso es muy bueno si quieres estudiar actina.

¿Qué sucede si desea estudiar algún factor de transcripción raro que solo se expresa en niveles bajos?
En sus 100.000 mRNA, puede haber solo 10 mRNA que codifiquen su factor de transcripción.
Ahora tendría que analizar toda su biblioteca de 100.000 clones.

Si su transcripción solo se expresó durante un corto período de tiempo en niveles bajos, es posible que esté presente en niveles aún más bajos.

La mayoría de los fagos recombinantes en una biblioteca de ADNc estándar llevan secuencias altamente expresadas.
Los ARNm raros son difíciles de encontrar a menos que su biblioteca sea muy grande (número de recombinantes - debe contener más de 10 6 recombinantes independientes para cubrir una población de ARNm de 100,000 transcripciones con 99% de probabilidad).

La alternativa al cribado de un número creciente de recombinantes independientes es "normalizar" la biblioteca utilizando la cinética de hibridación, como comentamos anteriormente.
Las bibliotecas normalizadas contienen menos copias de ARNm altamente expresados ​​(eliminados en la hibridación) y más copias de transcripciones raras (en un sentido relativo).


Retrovirus

Nuestros editores revisarán lo que ha enviado y determinarán si deben revisar el artículo.

Retrovirus, cualquiera de un grupo de virus que pertenecen a la familia Retroviridae y que portan característicamente su modelo genético en forma de ácido ribonucleico (ARN). Los retrovirus reciben su nombre de una enzima conocida como transcriptasa inversa, que fue descubierta de forma independiente en 1971 por los virólogos estadounidenses Howard Temin y David Baltimore. La transcriptasa inversa transcribe el ARN en ácido desoxirribonucleico (ADN), un proceso que constituye una inversión de la dirección habitual de la transcripción celular (ADN en ARN). La acción de la transcriptasa inversa hace posible que el material genético de un retrovirus se incorpore permanentemente al genoma del ADN de una célula infectada. La enzima se usa ampliamente en las ciencias biológicas para sintetizar genes.

Los retrovirus causan el crecimiento de tumores y ciertos cánceres en animales y están asociados con infecciones lentas de animales, como la anemia infecciosa equina. En los seres humanos, un retrovirus conocido como virus linfotrópico de células T humanas tipo 1 (HTLV-1) causa una forma de cáncer llamada leucemia de células T adultas (ATL). También puede causar una condición neurodegenerativa conocida como mielopatía asociada a HTLV-1 / paraparesia espástica tropical (HAM / TSP). Un virus estrechamente relacionado llamado HTLV-2 está asociado con trastornos neurológicos relativamente leves, pero no se ha identificado como agente causante de enfermedades humanas. Se cree que hasta 20 millones de personas en todo el mundo están infectadas con HTLV, pero solo un pequeño porcentaje de las personas infectadas desarrollan ATL o HAM / TSP. El retrovirus conocido como virus de inmunodeficiencia humana (VIH) causa el síndrome de inmunodeficiencia adquirida (SIDA) en humanos. El VIH está estrechamente relacionado con el virus de la inmunodeficiencia de los simios (VIS), un retrovirus que se encuentra en chimpancés y gorilas.

Los denominados retrovirus endógenos (ERV) son características persistentes de los genomas de muchos animales. Los ERV consisten en el material genético de virus extintos o "fósiles", cuya constitución genómica es similar a la de los retrovirus existentes. Los ERV humanos (HERV) se han distribuido dentro del ADN humano a lo largo de la evolución. Se transmiten de una generación a la siguiente y constituyen aproximadamente del 1 al 5 por ciento del genoma humano. Se sospecha que los HERV han influido en la evolución de ciertos elementos del genoma humano. También se les ha implicado en determinadas enfermedades humanas, incluida la esclerosis múltiple.

El HTLV-1 fue el primer retrovirus humano descubierto, habiendo sido detectado y aislado en 1979 por el virólogo estadounidense Robert C. Gallo y sus colegas. El VIH se aisló por primera vez en 1983.


La ocurrencia generalizada y los roles biológicos potenciales de los elementos virales endógenos en los genomas de insectos

Los enfoques modernos de secuenciación genómica y bioinformática han detectado numerosos ejemplos de secuencias de ADN derivadas de genomas de virus de ADN y ARN integrados en genomas de vertebrados e insectos. Los retrovirus codifican ADN polimerasas dependientes de ARN (transcriptasas inversas) e integrasas que convierten sus genomas virales de ARN en provirus de ADN y facilitan la integración del ADN proviral en el genoma del hospedador. Sorprendentemente, las secuencias de ADN derivadas de virus de ARN que no codifican estas enzimas también se encuentran en los genomas del hospedador. Las secuencias de virus de ARN integrado no retrovirales (NIRVS) ocurren con una frecuencia relativamente alta en los genomas de los vectores arbovirales Aedes aegypti y Aedes albopictus, no se distribuyen al azar y posiblemente contribuyan a la inmunidad antiviral de los mosquitos, lo que sugiere que estos mosquitos podrían servir como un sistema modelo para desentrañar la función de NIRVS. Aquí abordamos las siguientes preguntas: ¿Qué impulsa la síntesis de ADN a partir de los genomas de virus de ARN no retrovirales? ¿Cómo se produce la integración del ADNc del virus en el ADN del hospedador y cuál es su función biológica (si corresponde)? Revisamos el conocimiento actual de las integraciones virales en los genomas de insectos, planteamos la hipótesis de los mecanismos de formación de NIRVS y su impacto potencial en la biología de los insectos, en particular la inmunidad antiviral, y sugerimos direcciones para futuras investigaciones.


Los retrovirus 'tienen casi 500 millones de años'

Un retrovirus tiene una membrana que contiene glucoproteínas, que pueden unirse a una proteína receptora en una célula huésped. Hay dos cadenas de ARN dentro de la célula que tienen tres enzimas: proteasa, transcriptasa inversa e integrasa (1). El primer paso de la replicación es la unión de la glicoproteína a la proteína receptora (2). Una vez que estos se han unido, la membrana celular se degrada y se convierte en parte de la célula huésped, y las cadenas de ARN y las enzimas ingresan a la célula (3). Dentro de la célula, la transcriptasa inversa crea una cadena complementaria de ADN a partir del ARN del retrovirus y el ARN se degrada, esta cadena de ADN se conoce como ADNc (4). Luego, el ADNc se replica y las dos hebras forman un enlace débil y entran en el núcleo (5). Una vez en el núcleo, el ADN se integra en el ADN de la célula huésped con la ayuda de la integrasa (6). Esta célula puede permanecer inactiva o el ARN puede sintetizarse a partir del ADN y usarse para crear las proteínas de un nuevo retrovirus (7). Las unidades de ribosoma se utilizan para transcribir el ARNm del virus en las secuencias de aminoácidos que pueden convertirse en proteínas en el retículo endoplásmico rugoso. Este paso también producirá enzimas virales y proteínas de la cápside (8). Se producirá ARN viral en el núcleo. Luego, estas piezas se juntan y se separan de la membrana celular como un nuevo retrovirus (9). Crédito: Wikipedia / CC BY-SA 3.0

Los retrovirus, la familia de virus que incluye al VIH, tienen casi 500 millones de años, según una nueva investigación realizada por científicos de la Universidad de Oxford. Eso es varios cientos de millones de años más antiguo de lo que se pensaba anteriormente y sugiere que los retrovirus tienen orígenes marinos antiguos, habiendo estado con sus huéspedes animales a través de la transición evolutiva del mar a la tierra.

Los hallazgos, publicados en la revista Comunicaciones de la naturaleza, nos ayudará a comprender mejor la continua "carrera armamentista" entre los virus y sus anfitriones.

El autor del estudio, el Dr. Aris Katzourakis, del Departamento de Zoología de la Universidad de Oxford, dijo: "Se sabe muy poco sobre el origen antiguo de los retrovirus, en parte debido a la ausencia de registros fósiles geológicos. Los retrovirus se distribuyen ampliamente entre los vertebrados y también pueden transmitirse entre huéspedes , lo que lleva a enfermedades nuevas como el VIH, y se ha demostrado que son capaces de saltar entre huéspedes parientes lejanos, como aves y mamíferos. Pero hasta ahora, se pensaba que los retrovirus eran relativamente nuevos, posiblemente tan recientes como 100 millones de años en la edad.

"Nuestra nueva investigación muestra que los retrovirus tienen al menos 450 millones de años, si no más, y que deben haberse originado junto con, si no antes, sus huéspedes vertebrados en la era Paleozoica temprana. Además, habrían estado presentes en nuestro antepasados ​​vertebrados antes de la colonización de la tierra y han acompañado a sus anfitriones a lo largo de esta transición del mar a la tierra, hasta la actualidad ".

Los retrovirus son una familia de virus que incluye al virus VIH responsable de la pandemia del SIDA. También pueden causar cánceres e inmunodeficiencias en una variedad de animales. La parte 'retro' de su nombre proviene del hecho de que están hechos de ARN, que pueden convertir en ADN e insertar en el genoma de su anfitrión, en la dirección opuesta al flujo normal de información en una célula. Esta propiedad significa que ocasionalmente pueden heredarse como retrovirus endógenos (retrovirus con un origen interno), formando un registro fósil genómico virtual que puede usarse para mirar hacia atrás en su historia evolutiva.

Esta investigación utilizó secuencias del genoma de retrovirus endógenos que se asemejan a los virus "espumosos", un grupo de virus que tienden a divergir junto con sus huéspedes. Los virus espumosos están muy extendidos en los mamíferos, y en este estudio los investigadores desenterraron fósiles genómicos de retrovirus espumosos en huéspedes muy diversos, incluidos peces con aletas radiadas y anfibios en los que no se habían encontrado previamente.

Durante este estudio, los investigadores superaron una de las limitaciones clave al estudiar la profunda historia evolutiva de los virus: su rápida evolución. Este rasgo facilita la reconstrucción de la historia reciente de los virus, pero oculta su pasado más lejano. Sin embargo, un nuevo modelo utilizado en esta investigación, en combinación con los registros fósiles genómicos de los virus espumosos, permitió a los científicos explicar una aparente desaceleración en la tasa de evolución a medida que retrocedían.

El Dr. Katzourakis agregó: "Estos hallazgos muestran que este grupo de virus de importancia médica tiene al menos 500 millones de años de edad, mucho más antiguo de lo que se pensaba anteriormente. Se remontan a los orígenes de los vertebrados, y esto nos da el contexto en el que Debemos considerar su actividad e interacciones actuales con sus anfitriones. Por ejemplo, debemos considerar las adaptaciones que los vertebrados han desarrollado para combatir los virus, y las correspondientes contramedidas virales, como el producto de una carrera armamentista continua que se remonta a cientos de Millones de años.

"Nuestra fecha inferida de los orígenes de los retrovirus coincide con los orígenes de la inmunidad adaptativa y, por lo tanto, es probable que los retrovirus hayan desempeñado un papel importante en el surgimiento de esta herramienta clave en la defensa antiviral de los vertebrados. Como entendemos la naturaleza de la interacción entre virus e inmunidad del huésped, estaremos en una mejor posición para intervenir en esta carrera armamentista delicadamente equilibrada con el fin de desarrollar tratamientos e intervenciones novedosos.

"Y a medida que construimos una imagen más clara de los orígenes de los diversos grupos de virus que nos infectan hoy, deberíamos acercarnos a desentrañar el misterio de sus orígenes últimos".


Componentes utilizados en el RT-qPCR:

La selección de componentes para la PCR de transcripción inversa es tan crucial como la selección de las condiciones de temperatura, pero no se preocupe, el kit de PCR de transcripción inversa listo para usar contiene todos los ingredientes en el tampón de reacción y la mezcla de reacción.

Seleccionar cada ingrediente de la PCR y su cantidad es tan importante como seleccionar las condiciones de temperatura para la PCR. Hoy en día, los kits de PCR de transcripción inversa listos para usar hacen que su trabajo sea eficiente, ya que contiene todos los ingredientes. Veamos algunos componentes de RT-PCR,

  • Enzima transcriptasa inversa con actividad RNasa
  • RNase H (si la transcriptasa inversa no la tiene)
  • ADN polimerasa

Abstracto

Muchos virus llevan más de un segmento de ácido nucleico a la partícula del virión, pero los retrovirus son el único grupo conocido de virus que contienen dos copias idénticas (o casi idénticas) del genoma de ARN dentro del virión. Estos genomas de ARN se unen de forma no covalente mediante un proceso conocido como dimerización de ARN genómico. Excepcionalmente, la dimerización del ARN del genoma retroviral es de crucial importancia para la replicación retroviral eficiente. En este artículo, se revisa nuestra comprensión actual de la relación entre la conformación del genoma retroviral, la dimerización y la replicación.


Paso 7: análisis de datos

A. Normalización de datos & # x02014Comparative Cq método

La importancia de la normalización de los datos de qPCR se ha enfatizado repetidamente [1, 26]. La normalización de datos es un paso crítico en el flujo de trabajo de qPCR, ya que corrige las variaciones en múltiples pasos, incluida la purificación de ARN, la evaluación de la concentración de ARN, así como la transcripción inversa y la eficiencia de amplificación. Normalización con genes de referencia expresados ​​de forma estable como controles internos, conocida como C comparativaq o el & # x00394 & # x00394Cq método, es el método más común para la normalización de datos de ARNm. Sin embargo, esta técnica requiere una validación adecuada para asegurarse de que se realiza correctamente [27]. Para el comparativo Cq Para que el método sea válido, es importante asegurarse de que los genes de referencia y los genes diana tengan una eficiencia de amplificación similar, ya que un C comparativo válidoq El método se basa en un supuesto adicional de eficiencia de amplificación similar [28]. Se puede trazar una curva estándar para el & # x00394Cq (la diferencia entre el gen de referencia y el objetivo frente al logaritmo de la entrada de ADNc), y el valor absoluto de la pendiente debe ser & # x0003c0.1 [29]. Vea un ejemplo de & # x00394Cq Entre Ciclofilina y PGC-1 y # x003b1 en la figura 6. Si no es posible obtener genes de referencia con una eficiencia de amplificación similar a la diana, se sugiere utilizar el método Pfaffl para el cálculo, en el que el cálculo se ajusta por las diferencias en la eficiencia de amplificación de los genes diana y de referencia [30, 31].

El comparativo Cq método normaliza la Cq valor de un gen diana a los genes de referencia internos antes de que se realicen comparaciones entre muestras. Primero, la diferencia entre Cq valores (& # x00394Cq) del gen diana y la media geométrica de múltiples genes de referencia se calcula para cada muestra, y luego la diferencia en el & # x00394Cq (& # x00394 & # x00394Cq) se calcula entre dos muestras (p. ej., control y tratamiento, o antes y después del tratamiento). El cambio de veces en la expresión de las dos muestras se calcula como 2 - & # x00394 & # x00394Cq, donde 2 deriva de 1 + eficiencia y se supone que la eficiencia es 1 (es decir, 100% de eficiencia) [28]. Nuestra recomendación para usar el comparativo Cq El método se enumera en el recuadro 9.

Recuadro 9

Es importante asegurarse de que los genes de referencia y los genes diana tengan una eficiencia de amplificación similar cuando se utiliza el comparativo Cq de lo contrario, se debe considerar el método Pfaffl.

B. Elección de genes de referencia

Varios genes de referencia tradicionales se han utilizado ampliamente en el análisis de qPCR. Un artículo de revisión ha informado que el 33% y el 32% del análisis de expresión de 6 revistas de alto impacto utilizó gliceraldehído-3-fosfato deshidrogenasa (GAPDH) y actina beta (ACTB) como genes de referencia, respectivamente, para artículos publicados en 1999 [32]. Sin embargo, la misma revisión señaló que la expresión de ambos GAPDH y ACTB varía considerablemente en diferentes entornos experimentales en una variedad de tejidos [32]. GAPDH se identificó originalmente como un intermedio en la vía de la glucólisis y se esperaba que estuviera presente de manera estable en todas las células, por lo que se seleccionó como un gen de referencia. Sin embargo, otras actividades de GAPDH, incluidas las funciones de endocitosis, control de la traducción y replicación del ADN [33], no se reconocieron hasta más tarde [32].

Se han utilizado varios genes de referencia en diferentes estudios de ejercicio. Mahoney y col. - [34] informó que & # x003b2-2-microglobulina (B2M) y ACTB fueron los genes de referencia más estables después de 300 contracciones excéntricas, mientras que B2M y GAPDH fueron los más estables después de 75 min de ciclismo intermitente de alta intensidad. En otro estudio, se tomaron biopsias musculares antes, inmediatamente después y 4 h después de 30 min de carrera en cinta rodante al 70% del VO2máx, y se extrajo ARN de 40 fibras individuales. GAPDH se encontró que se expresa de manera estable en todas las muestras [35]. Por lo tanto, cuando se utilizan genes de referencia como controles internos para un estudio de ejercicio, la estabilidad de cada gen de referencia debe evaluarse cuidadosamente, y no existe un gen & # x02018-one-size-cabe-all & # x02019 que pueda usarse en todos los estudios y con todos los protocolos de ejercicio.

Para reducir la variabilidad del control interno, se recomienda utilizar múltiples genes para la normalización [36, 37]. Utilizando muestras obtenidas de líneas celulares de neuroblastoma, Vandesompele y sus colegas demostraron que la normalización con un único gen de referencia conducía a diferencias de 3,0 veces en el 25% y 6,4 veces en el 10% de los casos analizados [36]. La evaluación de genes de referencia se puede lograr mediante la ejecución de un análisis estadístico en el Cq valor o utilizando software disponible. Hay varios programas de software disponibles para la evaluación de genes de referencia utilizando diferentes enfoques analíticos, como BestKeeper [38], NormFinder [39] y GeNorm [36].

En nuestro laboratorio, tenemos seis genes de referencia de uso común, ACTB, Proteína de unión a caja TATA (TBP), Ciclofilina, GAPDH, B2M, y ARNr 18S (Tabla 4). Hay algunas razones por las que se eligieron estos genes de referencia candidatos. En primer lugar, estos seis genes son genes de referencia potencialmente expresados ​​de forma estable, y se utilizan ampliamente en el análisis de qPCR de muestras de músculo esquelético obtenidas en estudios de ejercicio en humanos [34, 35, 40]. En segundo lugar, pertenecen a diferentes clases funcionales, por lo que es poco probable que estén co-regulados. Sin embargo, usando comparativo Cq método, es difícil calificar pequeñas diferencias en la expresión génica (es decir, menos de 2 veces) a menos que se utilicen múltiples genes de referencia expresados ​​de forma estable para la normalización [36, 41].

Cuadro 4

GeneNo. de accesiónFunción (base de datos de secuencias de referencia del NCBI [42])
ACTB (actina beta) <"type": "entrez-nucleotide", "attrs": <"text": "NM_001101.3", "term_id": "168480144", "term_text": "NM_001101.3" >> NM_001101.3Este gen codifica una de las seis proteínas de actina diferentes, que es un componente principal del aparato contráctil y una de las dos actinas citoesqueléticas no musculares.
TBP (proteína de unión a caja TATA) <"type": "entrez-nucleotide", "attrs": <"text": "NM_003194.4", "term_id": "285026518", "term_text": "NM_003194.4" >> NM_003194.4Este gen codifica un factor de transcripción general que se une específicamente a una secuencia de ADN llamada caja TATA y ayuda a colocar la ARN polimerasa II sobre el sitio de inicio de la transcripción del gen.
Ciclofilina (PPIA, peptidil-prolil cis-trans isomerasa A) <"type": "entrez-nucleotide", "attrs": <"text": "NM_021130.4", "term_id": "665821272", "term_text": "NM_021130.4" >> NM_021130.4Este gen codifica una proteína que cataliza la isomerización cis-trans de enlaces peptídicos imídicos de prolina en oligopéptidos y acelera el plegamiento de proteínas.
GAPDH (gliceraldehído-3-fosfato deshidrogenasa) <"type": "entrez-nucleotide", "attrs": <"text": "NM_001289746.1", "term_id": "576583523", "term_text": "NM_001289746.1" >> NM_001289746.1Este gen codifica una enzima clave en la vía glucolítica, que cataliza la fosforilación oxidativa reversible de gliceraldehído-3-fosfato en presencia de fosfato inorgánico y dinucleótido de nicotinamida y adenina (NAD).
B2M (& # x003b2-2-microglobulina) <"type": "entrez-nucleotide", "attrs": <"text": "NM_004048.2", "term_id": "37704380", "term_text": "NM_004048.2" >> NM_004048.2Este gen codifica una proteína sérica en asociación con la cadena pesada de clase I del complejo principal de histocompatibilidad (MHC) en la superficie de casi todas las células nucleadas.
ARNr 18S (ARN, 18S ribosomal) <"type": "entrez-nucleotide", "attrs": <"text": "NR_003286.2", "term_id": "225637497", "term_text": "NR_003286.2" >> NR_003286.2Este gen representa la porción de una repetición de ADNr que codifica un ARNr 18S.

Experimento 4

En nuestro estudio de ejercicio en humanos (ver Materiales y métodos), se tomaron muestras de músculos de 9 participantes en reposo (línea de base), y luego inmediatamente después (0 h) y 3 h después (3 h) de la última sesión de entrenamiento de 4 semanas. intervención de formación. Todas las muestras de músculo se congelaron inmediatamente después de la biopsia de músculo, y el ARN de todas las muestras (n = 27) se extrajo usando RNeasy Plus Universal Mini Kit con un protocolo modificado (usando 2-propanol) para todas las muestras que obtuvimos un A260/A280 relación superior a 1,9 y una puntuación de RQI superior a 7 (utilizando un sistema de electroforesis automatizado Experion). Luego, realizamos la transcripción inversa para convertir el ARN en ADNc en una sola ejecución, antes de realizar el análisis de qPCR. Para encontrar genes de referencia expresados ​​de manera estable en todas las muestras en todos los puntos de tiempo, probamos seis genes de referencia (ACTB, TBP, Ciclofilina, GAPDH, B2M, y 18S rRNA Tabla 5 y Fig 7). Luego usamos RefFinder para evaluar la estabilidad de estos genes. RefFinder es una herramienta basada en web, que es capaz de ejecutar cuatro algoritmos bien establecidos simultáneamente (GeNorm [36], BestKeeper [38], NormFinder [39] y delta-CT comparativo [43]), asigna un peso apropiado a cada gen individual, y calcular la media geométrica de sus pesos para la clasificación final general [44]. Según la clasificación completa recomendada de RefFlinder, nuestros genes candidatos se clasificaron de más a menos estables como B2M, TBP, ARNr 18S, ACTB, GAPDH y Ciclofilina (Cuadro 5).

Cq valores de reacciones individuales usando ACTB, TBP, Ciclofilina, GAPDH, B2M, y ARNr 18S se presentan los cebadores. Todas las muestras son de un estudio de ejercicios (n = 9 participantes & # x000d7 3 puntos de tiempo = 27 muestras).

Cuadro 5

Orden de clasificación (de mayor a menor estable)
Método123456
Delta CTTBPB2MARNr 18SACTBGAPDHCiclofilina
BestKeeperB2MTBPARNr 18SACTBGAPDHCiclofilina
NormFinderTBPB2MARNr 18SACTBGAPDHCiclofilina
GenormARNr B2M / 18STBPACTBGAPDHCiclofilina
Ranking completo recomendadoB2MTBPARNr 18SACTBGAPDHCiclofilina

Para ilustrar cómo se pueden elegir los genes de referencia, elegimos Coactivador PPARG 1 alfa (PGC-1 y # x003b1) como ejemplo para el análisis de la expresión génica. PGC-1 y # x003b1 es un coactivador transcripcional que se enriquece en músculo esquelético. Se ha demostrado que el ejercicio puede aumentar PGC-1 y # x003b1 Contenido de ARNm en humanos [45]. La eficiencia de amplificación de los seis genes de referencia candidatos fue similar a la de nuestro gen objetivo, PGC-1 y # x003b1 (Cuadro 6). Usamos la media geométrica de los tres genes mejor clasificados por RefFinder (TBP, B2M, y ARNr 18S) para la posterior normalización de datos. Nuestras recomendaciones para elegir genes de referencia se enumeran en el Cuadro 10.

Tabla 6

GeneNo. de accesiónPrimers (adelante y atrás)Tamaño del amplicón (pb)Posición de inicio (bp)Eficiencia (%)Fuente
TBP (proteína de unión a caja TATA) <"type": "entrez-nucleotide", "attrs": <"text": "NM_003194.4", "term_id": "285026518", "term_text": "NM_003194.4" >> NM_003194.4 F: CAGTGACCCAGCAGCATCACT
R: AGGCCAAGCCCTGAGCGTAA
20512199[46]
Ciclofilina (PPIA, peptidil-prolil cis-trans isomerasa A) <"type": "entrez-nucleotide", "attrs": <"text": "NM_021130.4", "term_id": "665821272", "term_text": "NM_021130.4" >> NM_021130.4 F: GTCAACCCCACCGTGTTCTTC
R: TTTCTGCTGTCTTTGGGACCTTG
10093100[47]
B2M (& # x003b2-2-microglobulina) <"type": "entrez-nucleotide", "attrs": <"text": "NM_004048.2", "term_id": "37704380", "term_text": "NM_004048.2" >> NM_004048.2 F: TGCTGTCTCCATGTTTGATGTATCT
R: TCTCTGCTCCCCACCTCTAAGT
8658998[36]
ACTB (actina beta) <"type": "entrez-nucleotide", "attrs": <"text": "NM_001101.3", "term_id": "168480144", "term_text": "NM_001101.3" >> NM_001101.3 F: GAGCACAGAGCCTCGCCTTT
R: TCATCATCCATGGTGAGCTGGC
7026107Diseñado por autores
ARNr 18S (ARN, 18S ribosómico 5) <"type": "entrez-nucleotide", "attrs": <"text": "NR_003286.2", "term_id": "225637497", "term_text": "NR_003286.2" >> NR_003286.2 F: CTTAGAGGGACAAGTGGCG
R: GGACATCTAAGGGCATCACA
71144399[48]
GAPDH (gliceraldehído-3-fosfato deshidrogenasa) <"type": "entrez-nucleotide", "attrs": <"text": "NM_001289746.1", "term_id": "576583523", "term_text": "NM_001289746.1" >> NM_001289746.1 F: AATCCCATCACCATCTTCCA
R: TGGACTCCACGACGTACTCA
82388106[49]
PGC-1 & # x003b1 (coactivador PPARG 1 alfa) <"type": "entrez-nucleotide", "attrs": <"text": "NM_013261.3", "term_id": "116284374", "term_text": "NM_013261.3" >> NM_013261.3 F: CAGCCTCTTTGCCCAGATCTT
R: TCACTGCACCACTTGAGTCCAC
101199104[50]

Recuadro 10

Se recomienda probar múltiples genes de referencia [36, 37], y se debe evaluar la estabilidad de cada gen antes de elegir los genes de referencia apropiados para un estudio en particular. Recomendamos utilizar RefFinder para evaluar la estabilidad de los genes de referencia, ya que ejecuta cuatro algoritmos bien establecidos simultáneamente. Aparte de la estabilidad del gen de referencia, la eficacia de amplificación de los genes de referencia debería ser similar a la de los genes diana.

C.Normalizar la expresión génica mediante cuantificación de ADNc

Encontrar genes de referencia estables es un desafío al realizar qPCR, y los investigadores han estado buscando métodos alternativos como cuantificar el ADNc. El reactivo Quant-iT & # x02122 OliGreen ssDNA es un colorante de ácido nucleico fluorescente para cuantificar el cDNA y se ha utilizado en muchos artículos publicados, incluidos estudios que investigan la expresión génica en el músculo esquelético humano en respuesta al ejercicio [51 & # x0201353]. Un problema potencial con el uso de colorante OliGreen para cuantificar el contenido de ADNc es que el colorante también es sensible al ARN, como se indica en el manual del usuario & # x0201cel reactivo OliGreen muestra un aumento de la fluorescencia cuando se une al ARN& # x0201d [54].

Experimento 5

Para probar la especificidad y validez del uso de colorante OliGreen para calificar el contenido de cDNA, sintetizamos cDNA a partir de cuatro cantidades diferentes (0, 0,25, 0,5 y 1 & # x003bcg) de ARN obtenido del Experimento 1 (& # x02018 Good Practice & # x0201d, n = 4 para cada entrada de ARN). También cargamos ARN 1 & # x003bcg en la reacción de control & # x02013RT, que no contenía ADNc (n = 4). Usamos iScript & # x02122 Reverse Transcription Supermix (Bio-Rad) para la síntesis de cDNA. La enzima transcriptasa inversa de este kit tiene actividad ARNasa H + que degrada la cadena de ARN en híbridos ARN-ADN después de la síntesis de ADNc. A continuación, se midió el contenido de ADNc en cada muestra usando colorante OliGreen (Fig. 8A). De acuerdo con investigaciones anteriores [51], las muestras de ADNc sintetizadas a partir de diferentes cantidades de ARN mostraron una fuerte correlación positiva para la concentración de ADNc medida frente a la entrada de ARN (r = 0,9947, PAG& # x0003c 0,0001) (Figura 8B). Sin embargo, la reacción de control -RT, que contenía solo 1 & # x003bcg ARN pero no ADNc, mostró una lectura más alta que el ADNc sintetizado a partir de 0.5 & # x003bcg ARN. Este resultado confirmó que el tinte OliGreen no mide específicamente el ssDNA, sino que también mide el RNA. Esto podría provocar un contenido falso alto de ADNc en el ensayo si el ARN no se degrada correctamente. Nuestras recomendaciones para normalizar la expresión génica mediante la cuantificación del ADNc se enumeran en el Cuadro 11.

A: Determination of cDNA amount in reactions with different RNA input. Different amounts of RNA were used to synthesise cDNA (n = 4 for each RNA input), and the relative amount of cDNA in each reaction was measured using OliGreen dye. Values are presented as mean ± SD. B: Correlation between RNA input and average relative amount of cDNA measured.

Box 11

In order to obtain an accurate and specific measurement of cDNA from the Oligreen dye, RNA in the RNA-DNA hybrids needs to be degraded before measurement. This can be achieved by using a reverse transcriptase enzyme with RNase H + activity ( Fig 8 ), or including an RNase degradation step after cDNA synthesis [51].

D. Effect of normalisation methods on the results

Experiment 6

To investigate how normalisation might alter the outcome, we measured the exercise-induced expression of PGC-1α mRNA in the samples from a human exercise study (as described in Experiment 4) and analysed the same set of data in three ways. We performed normalisation using three of the most stable reference genes (TBP, B2M, y ARNr 18S), based on the reference gene evaluation ( Table 5 ). In comparison, we also used a single reference gene, Cyclophilin, which was the lowest ranked reference gene. Lastly, we analysed the data using the cDNA content measured by Quant-iT ™ OliGreen ssDNA Reagent. We saw a significant difference in gene expression at 3 hours after exercise using all three normalisation options (P < 0.01, Fig 9 ). These exercise-induced fold changes in PGC-1α expression are consistent with the existing literature [40, 45].

Muscle samples were taken at rest (Baseline, Week 0) and immediately post-exercise (0 h), and 3 h post-exercise. Data were analysed using 3 different normalisation methods. Values are fold change ± SD.

There were no significant differences between the fold changes in PGC-1α mRNA content when using different methods of normalisation however, the fold changes were more similar when using three reference genes and cDNA content for normalisation, rather than using one reference gene. The increase of PGC-1α was 3.4 ± 2.0 fold when three reference genes were used for normalisation. When a single reference gene (Cyclophilin) was used for normalisation, the increase in gene expression was 5.1 ± 2.4 fold (P = 0.08 compared to 3 reference genes). When cDNA content was used for normalisation, the increase of gene expression was 3.2 ± 1.9 fold (PAG = 0.51 compared to 3 reference genes, PAG = 0.09 compared to 1 reference gene). In certain experimental settings, especially when examining small changes in mRNA level, these different results could lead to different conclusions. This may also help to explain the inter-study variability for exercise-induced changes in mRNA content. As previously suggested, use of a single reference gene is considered ‘not acceptable’ unless its stability has been clearly demonstrated in the same study [1]. Our recommendations for normalising gene expression via reference genes are listed in Box 12.

Box 12

We recommend testing four or more candidate reference genes for each study, and selecting the ones that are stably expressed for data normalisation. In our research laboratory, we chose to use two to three most stable reference genes based on evaluation software for an individual study [45, 55].


DNA provirus hypothesis

In the mid-20th century there were many advances in molecular biology, including the description of DNA in 1953 by American geneticist and biophysicist James D. Watson and British biophysicists Francis Crick and Maurice Wilkins. By the 1960s it was understood that sarcomas are caused by a mutation that results in uncontrolled cell division. It was also evident that RSV was inherited during the division of cancerous cells. This inheritance occurred in a manner agreeing with the Mendelian laws of genetic inheritance—laws that heretofore had been understood to apply only to DNA molecules (ver the articles genetics and heredity).

Scientists hypothesized that, in order for such viral inheritance to occur, a virus would need to transcribe its RNA genome into DNA and then insert this DNA into the host cell genome. Once incorporated into the host genome, the virus would be transcribed as though it were another gene and could produce more RNA virus from its DNA. This hypothesis, called the “DNA provirus hypothesis,” was developed in the late 1950s by American virologist Howard Martin Temin, when he was a postdoctoral fellow in the laboratory of Italian virologist Renato Dulbecco at the California Institute of Technology. Temin’s hypothesis was formally proposed in 1964. The provirus hypothesis came about when experiments demonstrated that an antibiotic called actinomycin D, which is capable of inhibiting DNA and RNA synthesis, inhibited the reproduction of RSV. However, the concept of an RNA molecule’s turning itself into DNA drew very few supporters.


Ver el vídeo: RNA extraction and cDNA synthesis (Noviembre 2022).